ID: 916109875

View in Genome Browser
Species Human (GRCh38)
Location 1:161453837-161453859
Sequence ATCTGTCATCTCTACCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916109875_916109879 -10 Left 916109875 1:161453837-161453859 CCCAACAGGTAGAGATGACAGAT No data
Right 916109879 1:161453850-161453872 GATGACAGATACCCACGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916109875 Original CRISPR ATCTGTCATCTCTACCTGTT GGG (reversed) Intergenic
No off target data available for this crispr