ID: 916111462

View in Genome Browser
Species Human (GRCh38)
Location 1:161461248-161461270
Sequence ATCTGTCATCTCTACCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916111462_916111466 -10 Left 916111462 1:161461248-161461270 CCCAACAGGTAGAGATGACAGAT No data
Right 916111466 1:161461261-161461283 GATGACAGATACCCACGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916111462 Original CRISPR ATCTGTCATCTCTACCTGTT GGG (reversed) Intergenic
No off target data available for this crispr