ID: 916112454

View in Genome Browser
Species Human (GRCh38)
Location 1:161465161-161465183
Sequence CCGCGCCCGAATGCCCGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112454_916112463 9 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112463 1:161465193-161465215 GGTCCTTCCCCTGGAGACCCCGG No data
916112454_916112466 13 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG 0: 5
1: 0
2: 1
3: 21
4: 228
916112454_916112473 30 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data
916112454_916112465 12 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112465 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
916112454_916112460 0 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112454 Original CRISPR CCGCGCCCGAATGCCCGTGT GGG (reversed) Intergenic