ID: 916112456

View in Genome Browser
Species Human (GRCh38)
Location 1:161465162-161465184
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112456_916112463 8 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112463 1:161465193-161465215 GGTCCTTCCCCTGGAGACCCCGG No data
916112456_916112474 30 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112456_916112465 11 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112465 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
916112456_916112460 -1 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data
916112456_916112473 29 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data
916112456_916112466 12 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG 0: 5
1: 0
2: 1
3: 21
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112456 Original CRISPR CCCGCGCCCGAATGCCCGTG TGG (reversed) Intergenic