ID: 916112460

View in Genome Browser
Species Human (GRCh38)
Location 1:161465184-161465206
Sequence GCCACGGCCGGTCCTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112456_916112460 -1 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data
916112449_916112460 14 Left 916112449 1:161465147-161465169 CCACAGCAAATCTGCCCACACGG No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data
916112454_916112460 0 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data
916112448_916112460 17 Left 916112448 1:161465144-161465166 CCGCCACAGCAAATCTGCCCACA No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data
916112447_916112460 18 Left 916112447 1:161465143-161465165 CCCGCCACAGCAAATCTGCCCAC No data
Right 916112460 1:161465184-161465206 GCCACGGCCGGTCCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112460 Original CRISPR GCCACGGCCGGTCCTTCCCC TGG Intergenic