ID: 916112461

View in Genome Browser
Species Human (GRCh38)
Location 1:161465185-161465207
Sequence TCCAGGGGAAGGACCGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112461_916112474 7 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112461_916112475 10 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112461_916112479 30 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112461_916112478 29 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112461_916112473 6 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112461 Original CRISPR TCCAGGGGAAGGACCGGCCG TGG (reversed) Intergenic