ID: 916112462

View in Genome Browser
Species Human (GRCh38)
Location 1:161465191-161465213
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112462_916112479 24 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112462_916112478 23 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112462_916112473 0 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data
916112462_916112475 4 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112462_916112474 1 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112462 Original CRISPR GGGGTCTCCAGGGGAAGGAC CGG (reversed) Intergenic