ID: 916112464

View in Genome Browser
Species Human (GRCh38)
Location 1:161465196-161465218
Sequence CCGCCGGGGTCTCCAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112464_916112478 18 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112464_916112480 28 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112464_916112479 19 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112464_916112475 -1 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112464_916112474 -4 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112464_916112473 -5 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112464 Original CRISPR CCGCCGGGGTCTCCAGGGGA AGG (reversed) Intergenic