ID: 916112466

View in Genome Browser
Species Human (GRCh38)
Location 1:161465197-161465219
Sequence CTTCCCCTGGAGACCCCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112454_916112466 13 Left 916112454 1:161465161-161465183 CCCACACGGGCATTCGGGCGCGG No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG No data
916112449_916112466 27 Left 916112449 1:161465147-161465169 CCACAGCAAATCTGCCCACACGG No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG No data
916112448_916112466 30 Left 916112448 1:161465144-161465166 CCGCCACAGCAAATCTGCCCACA No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG No data
916112456_916112466 12 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112466 1:161465197-161465219 CTTCCCCTGGAGACCCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112466 Original CRISPR CTTCCCCTGGAGACCCCGGC GGG Intergenic