ID: 916112467

View in Genome Browser
Species Human (GRCh38)
Location 1:161465200-161465222
Sequence CTGCCCGCCGGGGTCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112467_916112475 -5 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112467_916112480 24 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112467_916112474 -8 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112467_916112479 15 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112467_916112473 -9 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data
916112467_916112478 14 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112467 Original CRISPR CTGCCCGCCGGGGTCTCCAG GGG (reversed) Intergenic