ID: 916112468

View in Genome Browser
Species Human (GRCh38)
Location 1:161465201-161465223
Sequence ACTGCCCGCCGGGGTCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112468_916112474 -9 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112468_916112480 23 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112468_916112479 14 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112468_916112475 -6 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112468_916112478 13 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112468_916112473 -10 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112473 1:161465214-161465236 GGCGGGCAGTCTCTCGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112468 Original CRISPR ACTGCCCGCCGGGGTCTCCA GGG (reversed) Intergenic