ID: 916112469

View in Genome Browser
Species Human (GRCh38)
Location 1:161465202-161465224
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112469_916112475 -7 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112475 1:161465218-161465240 GGCAGTCTCTCGACCCTGGGCGG No data
916112469_916112478 12 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112469_916112474 -10 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112469_916112480 22 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112469_916112479 13 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112469 Original CRISPR GACTGCCCGCCGGGGTCTCC AGG (reversed) Intergenic