ID: 916112471

View in Genome Browser
Species Human (GRCh38)
Location 1:161465211-161465233
Sequence GGGTCGAGAGACTGCCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112471_916112478 3 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112471_916112479 4 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112471_916112480 13 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112471 Original CRISPR GGGTCGAGAGACTGCCCGCC GGG (reversed) Intergenic