ID: 916112472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:161465212-161465234 |
| Sequence | AGGGTCGAGAGACTGCCCGC CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916112472_916112478 | 2 | Left | 916112472 | 1:161465212-161465234 | CCGGCGGGCAGTCTCTCGACCCT | No data | ||
| Right | 916112478 | 1:161465237-161465259 | GCGGCAGAGAAAGCGCAAGATGG | No data | ||||
| 916112472_916112479 | 3 | Left | 916112472 | 1:161465212-161465234 | CCGGCGGGCAGTCTCTCGACCCT | No data | ||
| Right | 916112479 | 1:161465238-161465260 | CGGCAGAGAAAGCGCAAGATGGG | No data | ||||
| 916112472_916112480 | 12 | Left | 916112472 | 1:161465212-161465234 | CCGGCGGGCAGTCTCTCGACCCT | No data | ||
| Right | 916112480 | 1:161465247-161465269 | AAGCGCAAGATGGGACGAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916112472 | Original CRISPR | AGGGTCGAGAGACTGCCCGC CGG (reversed) | Intergenic | ||