ID: 916112472

View in Genome Browser
Species Human (GRCh38)
Location 1:161465212-161465234
Sequence AGGGTCGAGAGACTGCCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112472_916112479 3 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112472_916112478 2 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112472_916112480 12 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916112472 Original CRISPR AGGGTCGAGAGACTGCCCGC CGG (reversed) Intergenic