ID: 916112474

View in Genome Browser
Species Human (GRCh38)
Location 1:161465215-161465237
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112469_916112474 -10 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112462_916112474 1 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112461_916112474 7 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112456_916112474 30 Left 916112456 1:161465162-161465184 CCACACGGGCATTCGGGCGCGGG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112464_916112474 -4 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112468_916112474 -9 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data
916112467_916112474 -8 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112474 1:161465215-161465237 GCGGGCAGTCTCTCGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr