ID: 916112478

View in Genome Browser
Species Human (GRCh38)
Location 1:161465237-161465259
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112464_916112478 18 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112467_916112478 14 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112461_916112478 29 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112471_916112478 3 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112462_916112478 23 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112470_916112478 4 Left 916112470 1:161465210-161465232 CCCCGGCGGGCAGTCTCTCGACC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112472_916112478 2 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112468_916112478 13 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data
916112469_916112478 12 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112478 1:161465237-161465259 GCGGCAGAGAAAGCGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type