ID: 916112479

View in Genome Browser
Species Human (GRCh38)
Location 1:161465238-161465260
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112461_916112479 30 Left 916112461 1:161465185-161465207 CCACGGCCGGTCCTTCCCCTGGA No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112468_916112479 14 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112471_916112479 4 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112472_916112479 3 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112470_916112479 5 Left 916112470 1:161465210-161465232 CCCCGGCGGGCAGTCTCTCGACC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112469_916112479 13 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112462_916112479 24 Left 916112462 1:161465191-161465213 CCGGTCCTTCCCCTGGAGACCCC No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112464_916112479 19 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data
916112467_916112479 15 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112479 1:161465238-161465260 CGGCAGAGAAAGCGCAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type