ID: 916112480

View in Genome Browser
Species Human (GRCh38)
Location 1:161465247-161465269
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916112470_916112480 14 Left 916112470 1:161465210-161465232 CCCCGGCGGGCAGTCTCTCGACC No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112472_916112480 12 Left 916112472 1:161465212-161465234 CCGGCGGGCAGTCTCTCGACCCT No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112468_916112480 23 Left 916112468 1:161465201-161465223 CCCTGGAGACCCCGGCGGGCAGT No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112464_916112480 28 Left 916112464 1:161465196-161465218 CCTTCCCCTGGAGACCCCGGCGG No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112476_916112480 -7 Left 916112476 1:161465231-161465253 CCCTGGGCGGCAGAGAAAGCGCA No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112467_916112480 24 Left 916112467 1:161465200-161465222 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112477_916112480 -8 Left 916112477 1:161465232-161465254 CCTGGGCGGCAGAGAAAGCGCAA No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112471_916112480 13 Left 916112471 1:161465211-161465233 CCCGGCGGGCAGTCTCTCGACCC No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data
916112469_916112480 22 Left 916112469 1:161465202-161465224 CCTGGAGACCCCGGCGGGCAGTC No data
Right 916112480 1:161465247-161465269 AAGCGCAAGATGGGACGAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type