ID: 916113044

View in Genome Browser
Species Human (GRCh38)
Location 1:161468593-161468615
Sequence GCTGTCTTCCAGGAGCTCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916113044_916113052 25 Left 916113044 1:161468593-161468615 CCGAAGAGCTCCTGGAAGACAGC No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data
916113044_916113051 21 Left 916113044 1:161468593-161468615 CCGAAGAGCTCCTGGAAGACAGC No data
Right 916113051 1:161468637-161468659 TAGAGATGACAGATACCCACGGG No data
916113044_916113050 20 Left 916113044 1:161468593-161468615 CCGAAGAGCTCCTGGAAGACAGC No data
Right 916113050 1:161468636-161468658 GTAGAGATGACAGATACCCACGG No data
916113044_916113046 -2 Left 916113044 1:161468593-161468615 CCGAAGAGCTCCTGGAAGACAGC No data
Right 916113046 1:161468614-161468636 GCACCTGAGATGCTCCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916113044 Original CRISPR GCTGTCTTCCAGGAGCTCTT CGG (reversed) Intergenic
No off target data available for this crispr