ID: 916113047

View in Genome Browser
Species Human (GRCh38)
Location 1:161468617-161468639
Sequence CTACCTGTTGGGAGCATCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916113047_916113051 -3 Left 916113047 1:161468617-161468639 CCTGAGATGCTCCCAACAGGTAG No data
Right 916113051 1:161468637-161468659 TAGAGATGACAGATACCCACGGG No data
916113047_916113052 1 Left 916113047 1:161468617-161468639 CCTGAGATGCTCCCAACAGGTAG No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data
916113047_916113050 -4 Left 916113047 1:161468617-161468639 CCTGAGATGCTCCCAACAGGTAG No data
Right 916113050 1:161468636-161468658 GTAGAGATGACAGATACCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916113047 Original CRISPR CTACCTGTTGGGAGCATCTC AGG (reversed) Intergenic
No off target data available for this crispr