ID: 916113048

View in Genome Browser
Species Human (GRCh38)
Location 1:161468628-161468650
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916113048_916113052 -10 Left 916113048 1:161468628-161468650 CCCAACAGGTAGAGATGACAGAT No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916113048 Original CRISPR ATCTGTCATCTCTACCTGTT GGG (reversed) Intergenic
No off target data available for this crispr