ID: 916113052

View in Genome Browser
Species Human (GRCh38)
Location 1:161468641-161468663
Sequence GATGACAGATACCCACGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916113045_916113052 15 Left 916113045 1:161468603-161468625 CCTGGAAGACAGCACCTGAGATG No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data
916113044_916113052 25 Left 916113044 1:161468593-161468615 CCGAAGAGCTCCTGGAAGACAGC No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data
916113048_916113052 -10 Left 916113048 1:161468628-161468650 CCCAACAGGTAGAGATGACAGAT No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data
916113047_916113052 1 Left 916113047 1:161468617-161468639 CCTGAGATGCTCCCAACAGGTAG No data
Right 916113052 1:161468641-161468663 GATGACAGATACCCACGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916113052 Original CRISPR GATGACAGATACCCACGGGA TGG Intergenic
No off target data available for this crispr