ID: 916114052

View in Genome Browser
Species Human (GRCh38)
Location 1:161472617-161472639
Sequence CTGCCCGCCGGGGTCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916114052_916114058 -9 Left 916114052 1:161472617-161472639 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916114058 1:161472631-161472653 GGCGGGCAGTCTCTCGACCCTGG No data
916114052_916114064 15 Left 916114052 1:161472617-161472639 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916114064 1:161472655-161472677 CGGCAGAGAAAGCGCAAGATGGG No data
916114052_916114063 14 Left 916114052 1:161472617-161472639 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916114063 1:161472654-161472676 GCGGCAGAGAAAGCGCAAGATGG No data
916114052_916114059 -8 Left 916114052 1:161472617-161472639 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916114059 1:161472632-161472654 GCGGGCAGTCTCTCGACCCTGGG No data
916114052_916114060 -5 Left 916114052 1:161472617-161472639 CCCCTGGAGACCCCGGCGGGCAG No data
Right 916114060 1:161472635-161472657 GGCAGTCTCTCGACCCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916114052 Original CRISPR CTGCCCGCCGGGGTCTCCAG GGG (reversed) Intergenic
No off target data available for this crispr