ID: 916116481

View in Genome Browser
Species Human (GRCh38)
Location 1:161489069-161489091
Sequence ATCTGTCATCTCTACCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916116478_916116481 -10 Left 916116478 1:161489056-161489078 CCATCCTGTGGGTATCTGTCATC No data
Right 916116481 1:161489069-161489091 ATCTGTCATCTCTACCTGTTGGG No data
916116475_916116481 12 Left 916116475 1:161489034-161489056 CCAGTGAGGGGATATAGGACATC No data
Right 916116481 1:161489069-161489091 ATCTGTCATCTCTACCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916116481 Original CRISPR ATCTGTCATCTCTACCTGTT GGG Intergenic
No off target data available for this crispr