ID: 916118437

View in Genome Browser
Species Human (GRCh38)
Location 1:161507628-161507650
Sequence GTGGAGTCGCTTTCTGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916118432_916118437 14 Left 916118432 1:161507591-161507613 CCTTTAAGGCTGCTGCTGTACCA 0: 1
1: 0
2: 0
3: 15
4: 200
Right 916118437 1:161507628-161507650 GTGGAGTCGCTTTCTGTTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80
916118435_916118437 -6 Left 916118435 1:161507611-161507633 CCAGAGAGATCCTGGCTGTGGAG 0: 1
1: 0
2: 3
3: 28
4: 287
Right 916118437 1:161507628-161507650 GTGGAGTCGCTTTCTGTTGATGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916118437 Original CRISPR GTGGAGTCGCTTTCTGTTGA TGG Intronic
901039258 1:6354401-6354423 GTGGGGTTGCTTTCTGTTTCTGG - Intronic
902772468 1:18653455-18653477 GAGGTGTCGCTTTCGGTTGTTGG + Intronic
907392456 1:54167159-54167181 GTGGAGGCAGTGTCTGTTGAAGG - Intronic
910178760 1:84458964-84458986 ATGGTGTCTCTTTCTGGTGAGGG + Intergenic
913067451 1:115269593-115269615 GCAGATTCGCTTTCTGGTGAGGG - Intergenic
916118437 1:161507628-161507650 GTGGAGTCGCTTTCTGTTGATGG + Intronic
919775933 1:201194074-201194096 GTGGATGCCCATTCTGTTGAAGG + Intronic
921750609 1:218788852-218788874 GTGGGGTTGGTTTCTGGTGAGGG + Intergenic
1063266645 10:4458798-4458820 GTGGAGTCACTTGCTGGTGAGGG - Intergenic
1065925955 10:30434032-30434054 GGGCAGTCTCTTTCTGTTTACGG + Exonic
1069700184 10:70418586-70418608 GTTGAATCATTTTCTGTTGAAGG + Intronic
1069945766 10:71984462-71984484 GTGGTGTGGCTTTGTGTTAAAGG - Intronic
1078110042 11:8385016-8385038 GTGGTGTCGCTTCCTGGGGAAGG - Intergenic
1080118391 11:28646246-28646268 GTTGAGTCGATTTCTGTATAAGG - Intergenic
1080354430 11:31425500-31425522 GTTGACTCGGTTTCTGATGAGGG + Intronic
1085242056 11:75065208-75065230 GTGGAGTTCCTCTCTGTTTAGGG - Intergenic
1086944973 11:92835983-92836005 GTGGAGCCGCTCTCTGCTGGAGG + Intronic
1090511598 11:127381305-127381327 ATGCAGTTGCTATCTGTTGATGG + Intergenic
1092182105 12:6453016-6453038 GTGGAGTAGCTTTCTGGGGAAGG + Intronic
1093909301 12:24727353-24727375 GTAGAGTCTCTCTCTGGTGAGGG - Intergenic
1094446486 12:30536246-30536268 GGGGAGTAGGTTTCTGTTCACGG + Intergenic
1094976451 12:36337225-36337247 GTGGATAAGCTTTCTTTTGATGG + Intergenic
1096543159 12:52319713-52319735 GTGGGGTGCCTTTCTGTTAAAGG - Intronic
1098037803 12:66323283-66323305 GTGGAGTGCCTGTCTGCTGAGGG + Intronic
1098780273 12:74677338-74677360 GTGGACATGCTTTTTGTTGATGG - Intergenic
1099364606 12:81752958-81752980 GTGGAGTCTCTTTCTGTCCCAGG + Intronic
1105726693 13:23169652-23169674 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
1108187714 13:47904825-47904847 GTGGAGGAGCTTTCTGGTGGTGG + Intergenic
1110077014 13:71258694-71258716 GAGGATTCACTCTCTGTTGAAGG + Intergenic
1112330567 13:98474368-98474390 GTGGACTCCCTTTCTCTTGTGGG + Intronic
1114314787 14:21499731-21499753 GTTGTGTTGCTTTCTTTTGAGGG - Intronic
1116647658 14:47549854-47549876 GCATAGTCGCTTTCTGGTGAGGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1130083294 15:80754263-80754285 GTGGAGCCCCTTTGGGTTGAAGG + Exonic
1133584419 16:7178926-7178948 GTGAAGTCTCTCTCTGTTTATGG + Intronic
1135970732 16:27070321-27070343 GTGGATTCGGTGTCTGGTGAGGG + Intergenic
1137329712 16:47480326-47480348 GTGGAGGCTCTTTCTGATGCTGG + Intronic
1138166368 16:54805489-54805511 GTGGATTGGCTTTCTGTGGTTGG - Intergenic
1142334535 16:89479112-89479134 GTGGCGTGACTTGCTGTTGATGG - Intronic
1145769616 17:27483812-27483834 GTGAAGTCACCTTCTGCTGAAGG + Exonic
1150217449 17:63478280-63478302 GGGGAGTTACTTTCTGTTAAAGG + Intergenic
1152144188 17:78558194-78558216 CTGGAATCTCTTTCTGTTGCTGG + Exonic
1153991843 18:10407381-10407403 GTAGATTAGCTTTTTGTTGAAGG - Intergenic
1158218808 18:55128904-55128926 GTGGAGTCCCAGTCTGTTGATGG + Intergenic
1166776391 19:45315464-45315486 GTGGAGAAGCTCTCTGTGGAAGG - Exonic
935036818 2:99384870-99384892 GTGGAGTCTCCTTCTGGTGAGGG + Intronic
948103816 2:235396822-235396844 GTGGAGTCTGTCTCTGATGATGG - Intergenic
1177483385 21:21723023-21723045 GTGCAGTTCCTTTCTGCTGATGG - Intergenic
1179822214 21:43943535-43943557 GAGGACTGGCTTTCTCTTGAGGG - Intronic
1181591272 22:23886460-23886482 GTGGATTCAGTGTCTGTTGAGGG + Intronic
952231987 3:31441468-31441490 TTTCAGTGGCTTTCTGTTGACGG - Intergenic
954769448 3:52952976-52952998 GTGTAGCTGCTTTCTGGTGAGGG - Intronic
960757452 3:121031590-121031612 ATGGATTGGCCTTCTGTTGAAGG - Intronic
966298586 3:178452886-178452908 GTGGAATTCATTTCTGTTGAGGG - Intronic
970716001 4:18923750-18923772 ATGGAGTCTCTCTCTGTTGCTGG - Intergenic
973052405 4:45611617-45611639 TTGGAGGAGCTTTCTGATGAGGG - Intergenic
974328676 4:60448162-60448184 GTGGACTTGGTGTCTGTTGAGGG - Intergenic
978580982 4:110231120-110231142 ATGGAGTCTCGTTCTGTTGCCGG + Intergenic
980816530 4:137953802-137953824 CTGGAATGGCTTTCTGTTTAGGG + Intergenic
982236646 4:153257223-153257245 CTGCAGTCACTTTCTGGTGATGG + Intronic
986603894 5:9502515-9502537 CTGGAGTCGCTTTCAGCTGTGGG + Intronic
989064248 5:37443825-37443847 ATGGAGTCTCTCTCTGTTGCTGG - Intronic
989480749 5:41927117-41927139 GTGGAGATACTTTTTGTTGAGGG + Exonic
990207829 5:53449182-53449204 ATGGAGTCTCTTTATGTTGCTGG - Intergenic
1001747270 5:174101189-174101211 GTGGTGACCCTTTCTGTTAAAGG - Intronic
1002812138 6:640741-640763 GTGGGGTTGGTTTCTTTTGAGGG - Intronic
1004434216 6:15575077-15575099 GTGGATTCGGTTTGTGTAGAAGG - Intronic
1012233072 6:96783124-96783146 GTAGAGACCATTTCTGTTGAGGG + Intergenic
1012947908 6:105487497-105487519 GTGGAGTCGATTTGAGATGAGGG + Intergenic
1013006248 6:106076854-106076876 GTGGAGTGGCTTTCCGTGAAAGG + Intergenic
1016188772 6:141233966-141233988 GTGGGGGCGCTTTTTGTTGCTGG - Intergenic
1017180951 6:151551554-151551576 CTGGAGTCACTTGCTCTTGAGGG + Intronic
1020142390 7:5619748-5619770 GTGCAGTCGGTTTCTTTTGCAGG - Intergenic
1024956738 7:54929042-54929064 GTGGAGTTGATTTTTGTTGGTGG - Intergenic
1031408538 7:121414494-121414516 GTGGTGTCAGGTTCTGTTGAGGG + Intergenic
1039487633 8:37923927-37923949 GTTGAGTTTCTTTCTGTTTATGG + Intergenic
1042072709 8:64954077-64954099 ATGGAGTCTCTTTCTGTAGCTGG - Intergenic
1042775875 8:72430727-72430749 GTAGATTTGGTTTCTGTTGAGGG + Intergenic
1046501332 8:115081630-115081652 TTGGAGTGGCTTTCTCCTGATGG + Intergenic
1058415599 9:104785435-104785457 GTGGAGTCGCTTTTTGCTCTGGG + Exonic
1186172584 X:6892866-6892888 GTAGAGTTGGTTTCTGGTGAGGG - Intergenic
1187673630 X:21693342-21693364 GTAGAGTTGGTTTCTGTTGTTGG - Intergenic
1190140830 X:47842386-47842408 GGGGAGTCTGTTCCTGTTGATGG + Intronic
1195740979 X:108064172-108064194 ATGGAGGGGCTTTCTGTTAAGGG - Intronic
1198915839 X:141670725-141670747 GTGGAGTAGATGTCTGGTGAGGG + Intronic
1200816433 Y:7538051-7538073 GTGGAGTTGGTGTCTGATGAGGG - Intergenic