ID: 916120499

View in Genome Browser
Species Human (GRCh38)
Location 1:161524665-161524687
Sequence GCCCCACGGGAGCTCGCGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916120491_916120499 9 Left 916120491 1:161524633-161524655 CCAGCATCCGACAAGAAGCTTCA 0: 2
1: 0
2: 1
3: 4
4: 104
Right 916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916120490_916120499 12 Left 916120490 1:161524630-161524652 CCTCCAGCATCCGACAAGAAGCT 0: 2
1: 0
2: 0
3: 5
4: 97
Right 916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916120488_916120499 21 Left 916120488 1:161524621-161524643 CCTCCGTGGCCTCCAGCATCCGA 0: 2
1: 0
2: 1
3: 11
4: 152
Right 916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916120492_916120499 2 Left 916120492 1:161524640-161524662 CCGACAAGAAGCTTCAGCCATGC 0: 2
1: 0
2: 1
3: 9
4: 144
Right 916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916120489_916120499 18 Left 916120489 1:161524624-161524646 CCGTGGCCTCCAGCATCCGACAA 0: 2
1: 0
2: 0
3: 10
4: 142
Right 916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916120499 Original CRISPR GCCCCACGGGAGCTCGCGGT GGG Exonic