ID: 916123660

View in Genome Browser
Species Human (GRCh38)
Location 1:161550605-161550627
Sequence GCCTAGGAGCCGGGGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916123649_916123660 11 Left 916123649 1:161550571-161550593 CCCTCCGGGCCACTGGATCTGGG 0: 2
1: 0
2: 0
3: 12
4: 150
Right 916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 228
916123651_916123660 10 Left 916123651 1:161550572-161550594 CCTCCGGGCCACTGGATCTGGGC 0: 2
1: 0
2: 2
3: 11
4: 221
Right 916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 228
916123654_916123660 2 Left 916123654 1:161550580-161550602 CCACTGGATCTGGGCTGGTCTGT 0: 2
1: 0
2: 6
3: 41
4: 360
Right 916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 228
916123647_916123660 12 Left 916123647 1:161550570-161550592 CCCCTCCGGGCCACTGGATCTGG 0: 2
1: 0
2: 4
3: 13
4: 167
Right 916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 228
916123652_916123660 7 Left 916123652 1:161550575-161550597 CCGGGCCACTGGATCTGGGCTGG 0: 2
1: 0
2: 3
3: 29
4: 321
Right 916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG 0: 1
1: 0
2: 3
3: 25
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916123660 Original CRISPR GCCTAGGAGCCGGGGCTCCA GGG Intronic
900565139 1:3328471-3328493 GCCTGGCAGCCGGGGCTCTTAGG + Intronic
900697453 1:4021114-4021136 GCCTGGGAGCAGGGGGTCGAGGG + Intergenic
900902651 1:5527402-5527424 AGATGGGAGCCGGGGCTCCAGGG - Intergenic
901003742 1:6161621-6161643 GCTTGGGAGCCGTGGCTCCAGGG - Intronic
901678098 1:10898494-10898516 GGCGGGGAGCCGGGGCGCCAGGG - Intergenic
902548508 1:17205487-17205509 GCCCAGGAGCTGGGGCCCCAAGG - Intronic
902637660 1:17745115-17745137 GAGTAGGAGCCCAGGCTCCAAGG - Intergenic
902731616 1:18373636-18373658 GCCCAGGAGCCGGGGTGCCCTGG + Intronic
902772856 1:18655843-18655865 GCCTAGGAGATGGGTCTCCCAGG - Intronic
903010081 1:20323554-20323576 CCCGAGGACCCGGGGCTCCAGGG + Intronic
904048090 1:27621496-27621518 GCCTTGGAGTCTGGACTCCAGGG + Intronic
904751149 1:32741988-32742010 GCCGAGGAGCCGGGGAACCCGGG + Exonic
904806826 1:33137939-33137961 GCCGAGGAGCTGAGGGTCCAGGG + Intergenic
904826723 1:33277930-33277952 GCCTAGCAGCAGGGGCGACAGGG - Intronic
906461050 1:46035322-46035344 CCCTAGGAGCCTGGGCCCAATGG + Exonic
907157290 1:52346126-52346148 GCCTTGGTGCCGGTGATCCATGG + Exonic
910676420 1:89821101-89821123 GCGGAGGAGCCGGGGCACCACGG - Exonic
913526806 1:119701598-119701620 GCCTAGGACACAGGGCACCAGGG + Intronic
913575727 1:120172479-120172501 GCTTAGGAGTAGGGGCTCCAGGG - Intronic
914558041 1:148788051-148788073 GCTTAGGAGTAGGGGCTCCAGGG - Intergenic
914614793 1:149342179-149342201 GCTTAGGAGTAGGGGCTCCAGGG + Intergenic
915068826 1:153248575-153248597 CCCTAGGATGAGGGGCTCCAAGG + Intergenic
916123660 1:161550605-161550627 GCCTAGGAGCCGGGGCTCCAGGG + Intronic
916133544 1:161631960-161631982 GCCTAGGATCCAGGGCTCCAGGG + Intronic
916946783 1:169737026-169737048 GCCTATGCACCGGGGATCCAGGG - Intronic
919853261 1:201688214-201688236 GCCTTGGACCCTGGGCTCCTTGG + Intronic
920306725 1:205023157-205023179 GGCTAGGAGACGGAGCACCATGG - Intergenic
920418370 1:205813318-205813340 GCCCAGGAGGCGGGGCGCCGGGG + Intronic
921273991 1:213499342-213499364 GGTTGGGGGCCGGGGCTCCATGG - Intergenic
922460836 1:225813351-225813373 GCTTAGGAGCAGAGTCTCCAAGG + Intronic
922776224 1:228215307-228215329 ACCCAGGGGACGGGGCTCCAGGG + Intronic
924260282 1:242222640-242222662 GCCTTGGGGCTGGGGCTGCAGGG - Intronic
924362305 1:243254821-243254843 GCCTGGGACCCGGGGCTTGACGG - Intronic
1063386856 10:5621192-5621214 GCGTGGGAGCCGGGGGTGCAGGG + Intergenic
1064251625 10:13710514-13710536 GCCTGGGAGCCGGGACTCCATGG - Intronic
1065855871 10:29829601-29829623 GCCTAGTAGGAGGGGCTTCAGGG - Intergenic
1067025065 10:42837199-42837221 GCCCAGCAGCCGGGGGTGCAGGG - Intergenic
1068801160 10:61141574-61141596 CCCTAGGAGCTGGGACTACAAGG + Intergenic
1069169212 10:65204143-65204165 ACCTAGGAGCCTGGGCTACCAGG - Intergenic
1069638225 10:69938382-69938404 GGCATGGAGCCCGGGCTCCAGGG - Intronic
1071974035 10:90937321-90937343 GCCCAGGAGCAGGAGCTCAAAGG - Intergenic
1072190369 10:93072950-93072972 GCCTCGGAGCCAGGACTCCTGGG + Intergenic
1073113096 10:101074291-101074313 GCCAAGGAGCTGTGGCTCAAAGG + Intergenic
1075064240 10:119278774-119278796 GCCAAGGAGGGAGGGCTCCAGGG - Intronic
1075210493 10:120486822-120486844 GCCTTGGAGCAGAGGCTCCCTGG + Intronic
1076555782 10:131320642-131320664 TCCTATGAGCCGGGAGTCCATGG + Intergenic
1076558060 10:131342924-131342946 GCCTGGGTGCCAGGACTCCATGG + Intergenic
1076560805 10:131362103-131362125 GCCTAGGAGCTGGGGCACCTGGG - Intergenic
1076809567 10:132879583-132879605 GCCTCGGACACGGGGCTCCGTGG + Exonic
1077110179 11:858854-858876 GCATGGGAGCCGGGGGTGCATGG - Intronic
1077218713 11:1405837-1405859 GCCAAGGAGCAGGGGCTGGATGG - Intronic
1077401515 11:2360425-2360447 GCCTAGGGGCCTTGGTTCCAAGG + Intergenic
1077497855 11:2895213-2895235 GCTGAGGGGCCAGGGCTCCAGGG + Intronic
1077635374 11:3838435-3838457 GCCTAGGAACTGGGACTCCTGGG + Intronic
1081533736 11:43982689-43982711 GCCTGGGAGTCAGGGGTCCAGGG + Intergenic
1084128683 11:67118170-67118192 GCCGAGGAGCGGGGGCTTCCTGG + Intergenic
1084207927 11:67606787-67606809 GCCTTGGCGCCGGGGCTTCTGGG - Intergenic
1085454974 11:76660513-76660535 GCCTAAGCGCCGGGCCTCAAAGG + Exonic
1087802193 11:102516478-102516500 GACTAGGAGCCTGGTGTCCATGG + Intergenic
1088223315 11:107591576-107591598 GCCTTGGTGCAGGGGCTCCGGGG + Intronic
1088663906 11:112074814-112074836 GCCAAGGAGTCAGGGCTCAAAGG - Exonic
1091444924 12:539204-539226 GGCTAGGGGCCTGGGCTTCATGG + Intronic
1091775469 12:3182107-3182129 GACTGGGGGCCGGGGGTCCAGGG - Intronic
1094603544 12:31931485-31931507 GCTTAGGAGCCTGGGCAACATGG + Intergenic
1096840959 12:54379075-54379097 CCCTGGGGGCCGCGGCTCCATGG + Intronic
1097277696 12:57824419-57824441 GCCCAGGAGGCTGGGCTGCAGGG - Intronic
1100329326 12:93570310-93570332 GACAAGGAGCCGGAGCGCCAGGG + Intronic
1101751112 12:107582999-107583021 AGTTAGGAGCCTGGGCTCCAGGG + Intronic
1103341007 12:120221191-120221213 GCGTGGGAGATGGGGCTCCAGGG + Intronic
1105662151 13:22508390-22508412 GTCCAGGAGCCGGGGCTTCCTGG - Intergenic
1105779634 13:23695415-23695437 GTCTCTGAGCCGGCGCTCCAAGG - Intergenic
1106172022 13:27296561-27296583 GGATAGGAGCTCGGGCTCCAGGG - Intergenic
1112257721 13:97850130-97850152 GGCTGGGAGGCTGGGCTCCATGG - Intergenic
1113082501 13:106534304-106534326 GCCAAGGCGCCCCGGCTCCAGGG + Intronic
1113082502 13:106534305-106534327 GCCCTGGAGCCGGGGCGCCTTGG - Intronic
1113505436 13:110812987-110813009 GCTGAGGAGCGGGAGCTCCAGGG + Intergenic
1114602802 14:23969902-23969924 GCGTGGGAGCCCGCGCTCCAAGG + Intronic
1115643429 14:35350213-35350235 GCCCAGGAGGCAGGGCCCCAAGG - Intergenic
1120072878 14:80123220-80123242 GCCTGGGCGCCTGGGCTCCTGGG - Intergenic
1120499259 14:85274351-85274373 GTCTAGGAGCTGGGACACCATGG - Intergenic
1120822523 14:88926143-88926165 GCATAGGAGCTGGAGCTCCAGGG + Intergenic
1120979893 14:90280203-90280225 CCCAAGTAGCCGGGACTCCATGG + Intronic
1121630168 14:95416192-95416214 GCCTAGGACCCGGGTCCCCAAGG + Intronic
1121781607 14:96625582-96625604 GCCTTCGACCAGGGGCTCCACGG - Intergenic
1122079137 14:99254688-99254710 GCCTCCTGGCCGGGGCTCCAAGG - Intronic
1122628613 14:103097338-103097360 GCATAGGAGCCGGGGCCCCCTGG + Intergenic
1122866164 14:104604925-104604947 GGCCAGGAGCCCGGGGTCCAGGG + Exonic
1123674044 15:22690509-22690531 GCCTTGGTGCCGGTGATCCATGG - Intergenic
1124326052 15:28763501-28763523 GCCTTGGTGCCGGTGATCCATGG - Intergenic
1124957220 15:34367303-34367325 GCGGAGGAGCAGGGGCGCCAGGG - Intergenic
1125903436 15:43369939-43369961 GCTTAGGAGTCTGGGTTCCAGGG + Exonic
1125973833 15:43933990-43934012 GTCTAGGAGGCGGGGCTGGAAGG + Intronic
1129070444 15:72946239-72946261 CCCTAGCAGCAGGGGCCCCAAGG + Intergenic
1129196768 15:73973177-73973199 ACCTAGGAGCCGAGGCTCCCAGG + Intergenic
1129659230 15:77543655-77543677 GACCAGGACCTGGGGCTCCAGGG + Intergenic
1129716840 15:77857233-77857255 GCCTGGGAGCCAGGCCTGCAAGG - Intergenic
1130064667 15:80593862-80593884 GCCGAGCAGCCGCGGCTGCAGGG - Exonic
1132066054 15:98732239-98732261 GCCTAGGAGCAGGGCCTCGCAGG + Intronic
1132665326 16:1078867-1078889 GGCTGGGAACAGGGGCTCCATGG - Exonic
1134552768 16:15145652-15145674 GCCTAGGGGCCGGGGTGCCCAGG - Intergenic
1135425914 16:22335806-22335828 GCCTAGAACCTGGGGCTGCAGGG - Intergenic
1136294892 16:29295918-29295940 CTAAAGGAGCCGGGGCTCCATGG - Intergenic
1137388838 16:48064832-48064854 GTCCAGGAGCCAGGCCTCCAGGG + Intergenic
1137564998 16:49527246-49527268 GCCTAGTTGCCAGGGCTCCAGGG - Intronic
1141179428 16:81742461-81742483 GCATGGGGGCTGGGGCTCCAGGG - Intronic
1141715979 16:85727084-85727106 GCCCAGGTGCCGGGGCTACAGGG - Intronic
1141966611 16:87449400-87449422 GCCTAGGAGCCCAGGAACCATGG - Intronic
1142100786 16:88269929-88269951 CTAAAGGAGCCGGGGCTCCATGG - Intergenic
1142147945 16:88500227-88500249 GGGCAGTAGCCGGGGCTCCAGGG - Intronic
1142181902 16:88675307-88675329 GGCTAGGAGCCTGTCCTCCAGGG - Intergenic
1142493485 17:293462-293484 GGCTGGGGGCCGGGGCTCCGGGG + Intronic
1143254257 17:5544069-5544091 ACCTATGAGCTGAGGCTCCATGG - Intronic
1143506415 17:7368176-7368198 GCCGAGGAGACGGGGCACCGTGG - Intergenic
1145276548 17:21434876-21434898 ACCAAGGTGCCGGGGCTGCACGG + Intergenic
1146685815 17:34841018-34841040 GGCGAGGAGCAGGGGCCCCAAGG - Intergenic
1147044811 17:37744481-37744503 GGCCCGGGGCCGGGGCTCCAGGG + Intronic
1147744320 17:42685889-42685911 GCCTAGGAGCTTGGACTCCATGG + Intronic
1148131883 17:45267055-45267077 GCCCCGGAGCCATGGCTCCAGGG - Intronic
1148782647 17:50130283-50130305 GCCGAGCAGCCGGGGCGCCGAGG + Intergenic
1148829921 17:50425018-50425040 CCCTAGGAACCGGGGTTCCAGGG + Intergenic
1151732251 17:75918351-75918373 GCCTGGGAGCAAGGGCTGCACGG - Intronic
1152087903 17:78231674-78231696 GCTGAGGAGCCGGGGGTTCAGGG + Exonic
1152554646 17:81046791-81046813 GCCTAGGATGCCAGGCTCCAGGG - Intronic
1152575977 17:81141068-81141090 GGCTAGGAGCCGTGGATGCAAGG + Intronic
1153900619 18:9614513-9614535 CCCGGGGAGCCGGGGCTACATGG + Exonic
1154122237 18:11661237-11661259 GCTTGGGAGCCGGGGCTTCTAGG - Intergenic
1157102667 18:44744398-44744420 GCCTGGGAACAGGGGCTCCCTGG + Intronic
1157544739 18:48539603-48539625 CCCTTGGCGCCGGAGCTCCAGGG - Intronic
1160789464 19:916974-916996 TCGTAGGGGCTGGGGCTCCAGGG - Intergenic
1160938634 19:1609784-1609806 GCTTGGGAGCCTGGGCCCCATGG - Exonic
1161118512 19:2512579-2512601 GCCTAGGAGCCCCGGCTGCCTGG + Exonic
1161137252 19:2627019-2627041 TCCCAGGAGCTGGGGCTCCCGGG - Intronic
1161369124 19:3899821-3899843 GCCAAGGAGCCAGTGCTCCTGGG + Intronic
1161475091 19:4480326-4480348 GCCTGGGAGCTGGGGGGCCAGGG - Intronic
1162053385 19:8049011-8049033 GCCTGGCAGACGGGGCTCCTGGG + Intronic
1162071440 19:8154753-8154775 GCCTATGAGGGGGGGCTCCATGG - Intronic
1162303444 19:9857279-9857301 GGCGTGGAGCCGGGCCTCCAGGG + Exonic
1163009092 19:14413571-14413593 GGCTTGGGGCAGGGGCTCCAGGG - Intronic
1165576159 19:36820817-36820839 GCCTAGGAGATGAGGCTGCAGGG + Intronic
1166504350 19:43361831-43361853 GGCTGGGGGCCGGGGCTCCTGGG + Intronic
1166733743 19:45072435-45072457 GCCCAGGAGCGGGGCCTCCGGGG + Exonic
1167331200 19:48857430-48857452 CCCTGGGACCCGGGCCTCCATGG - Exonic
1167377458 19:49119583-49119605 GCGTCGGAGACAGGGCTCCAGGG + Exonic
1167738366 19:51310845-51310867 GGCTGGGGGCCTGGGCTCCAGGG + Intergenic
1167738412 19:51310956-51310978 GGCTGGGGGCCTGGGCTCCAGGG + Intergenic
1167738458 19:51311067-51311089 GGCTGGGGGCCTGGGCTCCAGGG + Intergenic
1167738489 19:51311141-51311163 GGCTGGGGGCCTGGGCTCCAGGG + Intergenic
1168057134 19:53869965-53869987 GCCTGGGGGCCTGGGCTCCTGGG + Intronic
1168294911 19:55373621-55373643 GCCTGGGAGCCTGGACTCCTGGG - Intergenic
1168349315 19:55667069-55667091 GCATAGGAGCTGGGTCTCCTGGG + Intronic
925907112 2:8546130-8546152 GCCCAGCAGCCAGGGCTCCCAGG + Intergenic
929924043 2:46194884-46194906 TCCTGGGAGCCAGGACTCCAAGG - Intergenic
930096595 2:47570739-47570761 TCCTAGGCGCCCGGGATCCACGG - Exonic
931655230 2:64504887-64504909 GCCCAGAAGCCAGGGCTCCCTGG + Intergenic
932079876 2:68704236-68704258 GCCCAGGAGCCTGGGCAACATGG + Intronic
936182114 2:110275942-110275964 GCCAAGGGGCCAGGGCTTCATGG - Intergenic
936230454 2:110695731-110695753 GCCAAGGGGCCAGGGCTTCATGG + Intergenic
937248897 2:120511191-120511213 GTCCAGGTGCCGGGGCTCCAGGG + Intergenic
937429516 2:121826479-121826501 GCCAAGGAACCTGGACTCCAAGG - Intergenic
947535623 2:230939119-230939141 GCCTAGGCCCCAGGGCTGCAGGG - Intronic
948139280 2:235660911-235660933 GGCTAAGAGGCTGGGCTCCAAGG - Intronic
948741922 2:240053925-240053947 GCACAGGGGCAGGGGCTCCATGG - Intergenic
948801641 2:240435917-240435939 GCCTCGGGCCCGGAGCTCCATGG - Exonic
948805609 2:240452527-240452549 GCCTTGGTGCAGGGGCTCCTGGG - Intronic
948994549 2:241571872-241571894 GCCTTGGAGCCTGGGCTACCAGG - Intronic
949006718 2:241653584-241653606 GCCTAGGTGCCGGCACACCAGGG - Exonic
1172518607 20:35553206-35553228 GCCCAGGAGCCTGGGCAACATGG - Intronic
1175479909 20:59303357-59303379 GCCAAGGTGCAGGGGCTACAAGG - Intronic
1175572469 20:60034488-60034510 GCCTCGGAGCCGTGGCTACCAGG + Intergenic
1175837083 20:62003036-62003058 CCCTGGCGGCCGGGGCTCCAAGG - Intronic
1175924940 20:62466977-62466999 GCCTGGGAGGCGGGTGTCCAGGG - Intronic
1176072509 20:63234524-63234546 GCCCAGAAGCCAGGGCTGCAGGG - Intergenic
1176199491 20:63854094-63854116 GGCCAGGAGCTGGGGCTGCAAGG - Intergenic
1178110540 21:29365615-29365637 GGCTAGGAGCCTGGCCTCCCTGG - Intronic
1179547890 21:42124640-42124662 GCCTAGGAGCCAGGGCCAGAAGG + Intronic
1179954881 21:44733066-44733088 GCGGGGCAGCCGGGGCTCCACGG - Intergenic
1180846569 22:18986070-18986092 GCCCAGGAGCTGGGTCCCCATGG + Intergenic
1181360165 22:22328023-22328045 TCCTAGGAACAGGGCCTCCAGGG + Intergenic
1181639543 22:24189429-24189451 GCCAAGGAGCCGAGGCTGCAGGG - Intergenic
1183323699 22:37180301-37180323 GCCGAGGAGCCGTGGCTCCATGG - Exonic
1184242957 22:43221093-43221115 GCCTGGGAGCTGGGGCCCCAGGG - Intronic
1185116044 22:48938884-48938906 GGCGAGGAGCCCGGGCTGCATGG - Intergenic
1185285461 22:49997913-49997935 GCCTGGGAGGCTAGGCTCCAGGG + Intronic
1185332369 22:50257500-50257522 GGCTAGGGGCTGAGGCTCCATGG + Intronic
953970530 3:47343752-47343774 GCGCAGGAGCCGGGTCTCCCTGG + Exonic
955525998 3:59820385-59820407 GCCTAGGCCCCAGGGCACCATGG + Intronic
957632878 3:82740714-82740736 GCATAAGAGCCTGGGCTCCAGGG + Intergenic
961442110 3:126959380-126959402 GCCTGGGTGCTGGGGCTCCGAGG - Intronic
962437588 3:135380953-135380975 GCCCAGGAGCTGGGGCTACCTGG - Intergenic
963188940 3:142447817-142447839 GCCGAGGACCCGGGGCTCCGCGG - Intronic
963192388 3:142487210-142487232 GCCTAGGAGTTGTGGCTGCAGGG - Intronic
963554474 3:146771010-146771032 GCCTAGGAGCCATGCCTCCCAGG - Intergenic
966448988 3:180036722-180036744 GCCGAGTACCCGGAGCTCCAGGG - Exonic
968760953 4:2442627-2442649 GCCGAGGGTCCGGGGCTCCATGG - Intronic
970295200 4:14622240-14622262 GCTTAGCAGCCAGGGCTGCATGG - Intergenic
972450475 4:39192953-39192975 GCCTAGCAGCTGGGGCTCATGGG + Intronic
981759257 4:148175265-148175287 GGCTAGGAACCGCTGCTCCAAGG - Intronic
984590023 4:181606804-181606826 GCCTCATAGCCAGGGCTCCAAGG + Intergenic
985527663 5:415348-415370 GCCTAGGGGCCGAGTCTCCCTGG + Intronic
985527712 5:415484-415506 GCCTAGGGGCCGAGTCTCCCTGG + Intronic
985873385 5:2577018-2577040 CCAGAGGGGCCGGGGCTCCAGGG - Intergenic
998366492 5:141636108-141636130 TCCAAGGAGCTAGGGCTCCAGGG - Intronic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001502490 5:172248860-172248882 GCCTGGGAGGTGGGGCTGCAGGG + Intronic
1002568586 5:180127753-180127775 GACTAGGGGCTGGGGCACCACGG - Intronic
1004484379 6:16052067-16052089 GCCTAGGAGCCAGAATTCCAGGG + Intergenic
1005092845 6:22076935-22076957 GCCCAGGAGCCTGGGCAACATGG - Intergenic
1005508225 6:26488887-26488909 CCCTAGTAGCCGGGACTACAGGG - Intergenic
1006259676 6:32857372-32857394 GCCTACCAGCTGGAGCTCCATGG + Exonic
1007499040 6:42281266-42281288 GCCCCGGAGCCTGGGCTGCAGGG + Intronic
1007588596 6:43007921-43007943 GTCTAGGAGCTGGGGGTACAAGG - Exonic
1007632994 6:43283185-43283207 GTCCAGGGGCCGGGCCTCCATGG + Exonic
1008759935 6:54842217-54842239 GCCTGGGAGCCTGGGCGCCTGGG - Intergenic
1014724888 6:124962370-124962392 GCCTCGGAGCACGGGCTCCCCGG + Intergenic
1019738380 7:2661308-2661330 GCCTTGGAGCTGTGGCTCCTGGG + Intronic
1020445361 7:8262093-8262115 TCCTGGGGGCCGGGGCTCCGAGG - Exonic
1022505837 7:30908275-30908297 CCCTAGGAGGCTGGGCTCCAGGG - Intergenic
1024301812 7:47892742-47892764 GCCTTGGAGACAGGGCTGCAGGG + Intronic
1025280485 7:57623547-57623569 GGCTGGGTGCCTGGGCTCCAGGG - Intergenic
1025304246 7:57841960-57841982 GGCTGGGTGCCTGGGCTCCAGGG + Intergenic
1026962504 7:74417689-74417711 GACTAGGAGCCGGGACACCTGGG - Intergenic
1028581445 7:92413549-92413571 GCATAGGAGCTGGGACTCCAGGG - Intergenic
1032500841 7:132398576-132398598 GTTTAAGAGCCTGGGCTCCAGGG + Intronic
1033579073 7:142715387-142715409 GCCAAGGAGCTGGGGGCCCATGG - Intergenic
1033657193 7:143381936-143381958 GGCTGGGAGCCAGGGCTCCTGGG + Intronic
1034531244 7:151697521-151697543 GCCAAGGACCAGGGGCTCCGGGG - Intronic
1035024392 7:155816427-155816449 GCATGTGAGCCGGGTCTCCACGG - Intergenic
1035038996 7:155913964-155913986 GGCCTGGAGCGGGGGCTCCATGG + Intergenic
1035972528 8:4265934-4265956 GCCCAGGAGACGGGGAACCATGG + Intronic
1037467154 8:19172009-19172031 GCTGGGGAGGCGGGGCTCCAGGG - Intergenic
1039247589 8:35626469-35626491 GCCTAGGAGCATGGTTTCCATGG - Intronic
1039923165 8:41907073-41907095 GCCTAGGAGCCGAGGCACTTAGG + Intergenic
1043517060 8:81004733-81004755 GCCTGGCAGCAGAGGCTCCATGG + Intronic
1047510747 8:125513459-125513481 ACCTGGGAGCGGGGGCTGCAGGG + Intergenic
1048345177 8:133570580-133570602 GCCTTGCAGCCGGGTCTCCCAGG - Intronic
1049565942 8:143339077-143339099 ACCCAGAAGCCGGAGCTCCAAGG + Intronic
1052664951 9:31484015-31484037 GGCTTGGAGCCTGGACTCCAAGG - Intergenic
1053421750 9:37984180-37984202 GTCTTGGAGATGGGGCTCCAAGG - Intronic
1054961633 9:70976392-70976414 GCCTAGTAGCCTGGTGTCCAGGG - Intronic
1055085181 9:72306425-72306447 GCCCAGGATCCTGGGCTCAAGGG - Intergenic
1056548309 9:87631080-87631102 ACCTAGGAGCCAGGCCTCGAAGG + Intronic
1057190273 9:93083348-93083370 GCCTGGGAGCCCGGGGCCCAGGG - Intronic
1057720603 9:97528809-97528831 GCCTAGGTGCCAAGGCACCAGGG - Intronic
1060656177 9:125374219-125374241 CCCTAGGAGCACAGGCTCCAGGG - Intergenic
1061971739 9:134048896-134048918 GCCTGAGAGCGGGGGCTCCGCGG + Intronic
1062209995 9:135358362-135358384 GCCTAGGAGGTGGGGCTGCCGGG + Intergenic
1062361737 9:136191536-136191558 GTCCAGGAGCCGGGGAGCCACGG - Intergenic
1062656243 9:137605649-137605671 GCCTCGGAGCCGGGACTCGCGGG + Exonic
1189335523 X:40168642-40168664 GCCAAGGGGCTGGGGCTCCCCGG + Intronic
1195757680 X:108215517-108215539 TCCTAGGAGCCTGGCCTCTATGG + Intronic
1196457067 X:115898394-115898416 GCCAAGGAGCCTGGGCTCAGGGG - Intergenic
1198543186 X:137662174-137662196 GCCTTGGTGCCGGTGATCCATGG + Intergenic
1200066686 X:153507341-153507363 GGCAGGGAGCAGGGGCTCCATGG + Intronic
1200091430 X:153637881-153637903 GACTAGCAGCCAGGGCCCCATGG - Intergenic
1200138693 X:153886744-153886766 GCGCAGGAGCCGGTGCTCCGCGG - Intronic
1200883657 Y:8246339-8246361 GCCTAGGAACCATGCCTCCAAGG + Intergenic
1201946201 Y:19513189-19513211 GCCTAGGAGCTTAAGCTCCAAGG + Intergenic