ID: 916124977

View in Genome Browser
Species Human (GRCh38)
Location 1:161561420-161561442
Sequence ATGTGTTATGGGAAGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916124970_916124977 25 Left 916124970 1:161561372-161561394 CCTCCCAGACTTGCAAGTTTTTA No data
Right 916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG No data
916124971_916124977 22 Left 916124971 1:161561375-161561397 CCCAGACTTGCAAGTTTTTAAAG No data
Right 916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG No data
916124972_916124977 21 Left 916124972 1:161561376-161561398 CCAGACTTGCAAGTTTTTAAAGT No data
Right 916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916124977 Original CRISPR ATGTGTTATGGGAAGGATAC TGG Intergenic
No off target data available for this crispr