ID: 916129987

View in Genome Browser
Species Human (GRCh38)
Location 1:161604617-161604639
Sequence AAATAGCCACCTATGGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 116}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916129983_916129987 6 Left 916129983 1:161604588-161604610 CCTAGTGGGTTCTAACCTGTCAA 0: 2
1: 0
2: 0
3: 8
4: 66
Right 916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG 0: 1
1: 1
2: 0
3: 15
4: 116
916129985_916129987 -9 Left 916129985 1:161604603-161604625 CCTGTCAAAGGAGAAAATAGCCA 0: 2
1: 0
2: 0
3: 8
4: 190
Right 916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG 0: 1
1: 1
2: 0
3: 15
4: 116
916129978_916129987 30 Left 916129978 1:161604564-161604586 CCTCTTAAAAAGTCCCTTGAACT 0: 2
1: 0
2: 1
3: 12
4: 194
Right 916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG 0: 1
1: 1
2: 0
3: 15
4: 116
916129981_916129987 17 Left 916129981 1:161604577-161604599 CCCTTGAACTTCCTAGTGGGTTC 0: 2
1: 0
2: 0
3: 3
4: 94
Right 916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG 0: 1
1: 1
2: 0
3: 15
4: 116
916129982_916129987 16 Left 916129982 1:161604578-161604600 CCTTGAACTTCCTAGTGGGTTCT 0: 2
1: 0
2: 0
3: 4
4: 120
Right 916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG 0: 1
1: 1
2: 0
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916129987 Original CRISPR AAATAGCCACCTATGGAGTA AGG Intronic
907093559 1:51752877-51752899 ATATAGCCACCTTTGGGGTTAGG + Intronic
907818920 1:57947713-57947735 AAATTGACGCCTATGGAGAATGG + Intronic
913065510 1:115249576-115249598 AAATAGCAACTTTTGAAGTATGG + Intergenic
913477972 1:119257316-119257338 AAATAGCCTCCTAAGGACTTTGG + Intergenic
916120226 1:161522968-161522990 AAATAGCCATCTATGGAGTAAGG + Intronic
916129987 1:161604617-161604639 AAATAGCCACCTATGGAGTAAGG + Intronic
918865018 1:189884651-189884673 AAATAGCCACTGTGGGAGTAAGG - Intergenic
922503199 1:226111361-226111383 ACATAGCCACCTCTGGAGTGTGG + Intergenic
923551712 1:234969569-234969591 AAATAGCCACATATGGTTTGGGG + Intergenic
923973616 1:239234115-239234137 AAATAGCCACCTATAGCTAATGG - Intergenic
924545702 1:245025068-245025090 AATTACACACCTTTGGAGTATGG + Intronic
1063656489 10:7995421-7995443 AAATGGCAACCTATAGAATAAGG - Intronic
1064392853 10:14956431-14956453 AAATAGCCAGGCATGGAGTCAGG + Intergenic
1066163677 10:32762024-32762046 AAATATCCACATATTGGGTAGGG + Intronic
1067500369 10:46798407-46798429 AAAAAGCAACCTATGGAAGATGG - Intergenic
1067594260 10:47541905-47541927 AAAAAGCAACCTATGGAAGATGG + Intronic
1067641369 10:48050020-48050042 AAAAAGCAACCTATGGAAGATGG + Intergenic
1070138618 10:73718898-73718920 AAAAAGCAACCTATGGAAGATGG + Intergenic
1073559254 10:104482903-104482925 AAATACCCACCTATGGTGTGAGG + Intergenic
1074183341 10:111081830-111081852 GAATAGCCACTTATGGAGGAGGG + Intergenic
1083078293 11:60064743-60064765 AAATAGCTATCCATGGAGGAGGG - Intronic
1088112668 11:106279814-106279836 AAATAGCCAACAAGAGAGTAAGG - Intergenic
1088246653 11:107825014-107825036 AAATAGCCATATATGGAGAATGG + Intronic
1088295382 11:108287842-108287864 AAATAGCCACCTTTGAATTGAGG + Intronic
1089846236 11:121460774-121460796 TAAGAGCCACCTGTGGAGAAAGG + Intronic
1090797737 11:130149582-130149604 AAAAAACCACCTTTAGAGTATGG - Intergenic
1090932422 11:131310131-131310153 TAATGGCCACCTGTGGAGGAGGG - Intergenic
1091141409 11:133238259-133238281 CAACAGCCACCTATGGAGAGTGG - Intronic
1093462911 12:19422404-19422426 AAGTAGCCACCTGGGGAGTATGG - Intronic
1093496464 12:19763377-19763399 ATAAAGCCACCTAGGGGGTATGG - Intergenic
1093661467 12:21762494-21762516 AAATTGACACCTAGGGAGTCTGG + Intergenic
1097725333 12:63069314-63069336 AATTAACCACTTATGGAGTTGGG - Intergenic
1100556779 12:95702368-95702390 AAACAGCCATCTAAGAAGTAGGG + Intronic
1109213982 13:59566409-59566431 AAATAGCCACATGTGGACAATGG - Intergenic
1109956323 13:69571786-69571808 AAATAGCAACCCAAGTAGTAAGG + Intergenic
1111386229 13:87531888-87531910 AAATATCCACTTATTAAGTAGGG + Intergenic
1111965356 13:94856463-94856485 AAATAGCCACTTATGGCTGAGGG + Intergenic
1113174235 13:107543987-107544009 AAAAATCTACCTGTGGAGTAGGG + Intronic
1113447384 13:110379758-110379780 GCATAGCCACCTAGGGAGTGGGG - Intronic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1115311902 14:31987308-31987330 AAATAGGAACCTCAGGAGTAAGG - Intergenic
1116693662 14:48144427-48144449 ACATAGCCATGCATGGAGTAAGG + Intergenic
1117308400 14:54498460-54498482 GAATAGCCACCCATGCAGGAAGG - Intergenic
1118417834 14:65562660-65562682 CAATTACCACCTCTGGAGTAAGG - Intronic
1119010897 14:70987387-70987409 AAATAGCCACATATGGCTAATGG + Intronic
1121672945 14:95726900-95726922 CAATAGCCACATATGGACAATGG - Intergenic
1124047652 15:26164810-26164832 AAATGGTTACCTATGGAGTATGG + Intergenic
1124635843 15:31364881-31364903 AAATGGCCTCCTAAGGAGTTAGG + Intronic
1125473658 15:40028777-40028799 AAATAGCCAAGTAGTGAGTATGG + Intronic
1127397058 15:58551379-58551401 AAATAGCCACATATGGTTTGTGG - Intronic
1129155537 15:73715021-73715043 AAATAGCCACCTATGCATAGTGG + Intergenic
1130937157 15:88480204-88480226 AAATAAAAACCTATGGTGTATGG - Exonic
1135218819 16:20595351-20595373 TGTTAGCCACCTATGGAGTGCGG - Intergenic
1138760426 16:59537242-59537264 AAATAGAAGCCTAAGGAGTACGG + Intergenic
1167218766 19:48183454-48183476 AAATAGCCACCTATGGCTATTGG + Intronic
1167277565 19:48548025-48548047 AAATAGCCACCTATGGCCAGTGG + Intergenic
1167658957 19:50784653-50784675 GAAAAGCCAGCTTTGGAGTAGGG - Intergenic
927885986 2:26719083-26719105 AAATATCCACCAATAGAGTTTGG - Intronic
929550075 2:42884614-42884636 GAATCGCCACCTATGGAATGAGG + Intergenic
934574237 2:95390449-95390471 AAAGAACCACCTTTGGAGGAGGG - Intergenic
939106921 2:137959847-137959869 AAAGAGACACCTGGGGAGTAAGG + Intergenic
939981905 2:148792554-148792576 AGATAGCCACCTAGGGAGGTGGG - Intergenic
940941100 2:159561622-159561644 AAATAGCCACATGTGGCTTATGG + Intronic
942090086 2:172481320-172481342 AAATAGCCACATAAGGACTAGGG + Intronic
943655411 2:190503369-190503391 TAATAGCCACATATGGCTTATGG - Intronic
948617694 2:239211967-239211989 AAATAGTCAGCTAAGGAGAATGG - Intronic
1168960159 20:1863636-1863658 AATCAGCCACATAGGGAGTAGGG + Intergenic
1171339142 20:24413361-24413383 AAATAGGCATTTATGGAGCAGGG - Intergenic
1173155004 20:40601244-40601266 AAATAGTAACCTATTGAGAAGGG - Intergenic
1175519972 20:59596070-59596092 GAATAGCTACCCATGGAGGAGGG - Intronic
1175526110 20:59634895-59634917 AAATAGCCACCTGTGGCTAATGG + Intronic
1176612675 21:8999402-8999424 TAATAGCCTCCAATGGAGTGGGG + Intergenic
1179495625 21:41769613-41769635 AAATGGCCCCCTATGAAGAAGGG - Intergenic
1179877685 21:44279299-44279321 AATTGGACACCCATGGAGTAGGG + Intergenic
1183761235 22:39820275-39820297 AAAAAGCCACCTCTGTGGTAAGG + Intronic
949948539 3:9209729-9209751 AAATTGCCACCAATGGAGTTTGG + Intronic
950352941 3:12374998-12375020 AAATAGCCATCTATGTGTTAAGG - Intronic
952723323 3:36556071-36556093 AAAAAGCCAGCTAAGGAGAATGG + Intergenic
952822144 3:37494702-37494724 AAATAGCCTCCTCTGGTGTGAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954952482 3:54487749-54487771 AAATAGCCACCCATGGCTTGTGG - Intronic
962101892 3:132351370-132351392 AAATAGCTGCCCATGGAGTCTGG + Intronic
963402421 3:144816881-144816903 AAATAGCCACCTATGGCTTCAGG - Intergenic
963766809 3:149345348-149345370 AAATATCTACTTATGGAGGAGGG - Intergenic
965097737 3:164255686-164255708 AAATAGACACCTATTCAGTCTGG + Intergenic
966904250 3:184510220-184510242 AAATAGCTACCTGTGGAGGAAGG + Intronic
969076281 4:4580745-4580767 AAATAGCCAGATCTGGAGTCAGG - Intergenic
969960389 4:10939379-10939401 AAATTGGCACCAATGGAATAGGG + Intergenic
976055731 4:81063554-81063576 AAATAGCCACCTATGGCTAGTGG - Intergenic
983106175 4:163689560-163689582 AAATAGTCACCTATGGCTAATGG + Intronic
987638523 5:20579224-20579246 AAACAGCCAACTATGGTGGAAGG + Intergenic
987817953 5:22928629-22928651 AAATTGACACCTGTAGAGTAAGG - Intergenic
988919019 5:35923498-35923520 AAATGTCCACCTATGGATAAAGG + Intronic
989503407 5:42196469-42196491 AACTAGCCATCTATGTAGTTTGG + Intergenic
991349022 5:65701600-65701622 AAATAGCCACATATGGCTTATGG - Intronic
992409765 5:76493600-76493622 AAAGAGCCACCTATGGGGTGGGG - Intronic
994240257 5:97411018-97411040 ATATACCAACCTAAGGAGTATGG - Intergenic
995973700 5:118005034-118005056 AAATATAAACCTATGGAATATGG + Intergenic
996041048 5:118811585-118811607 AAATTGTTACCTTTGGAGTAAGG + Intergenic
996791041 5:127293177-127293199 AAACAGCCACCAATGAAGTAAGG - Intronic
1000397730 5:160793219-160793241 AAATAGGCTCCTAAAGAGTATGG - Intronic
1000886467 5:166753418-166753440 AAATAGCCAGGTATGGTGTTGGG - Intergenic
1005187477 6:23179496-23179518 TAAGAGTCACCTATGGAATATGG + Intergenic
1005977970 6:30814780-30814802 AAATAAACACCTATGAAGTTAGG + Intergenic
1010395728 6:75390041-75390063 AAATAACCACCTCTGGAGGTAGG - Intronic
1016072371 6:139754980-139755002 ATTTAGCCAGCTATGGAGTTAGG + Intergenic
1018745545 6:166758917-166758939 AAATAGCAACCACTGGAGAAAGG - Intronic
1022172931 7:27846888-27846910 AAATAGCAATCTATGGATTAGGG - Intronic
1022909514 7:34887058-34887080 AAATAGTCACCTAAGCAATAAGG + Intergenic
1023124317 7:36939993-36940015 CAATTGCCACCTGTGGAGTCAGG - Intronic
1024168573 7:46759979-46760001 AAATACCCATTTATGGAGAATGG - Intergenic
1025852194 7:65252466-65252488 AAGTTGCCACCTAAGGAGGAGGG - Intergenic
1029743415 7:102503748-102503770 AAAGACCCATCTATGGAGAAAGG - Intronic
1029761404 7:102602909-102602931 AAAGACCCATCTATGGAGAAAGG - Intronic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030912393 7:115266969-115266991 AAATGGTCACCTATGAAGAAAGG - Intergenic
1031256650 7:119459965-119459987 AAATAGCTACAAATGTAGTAGGG + Intergenic
1034760942 7:153671390-153671412 AAACAGCCACTTAGGGAGTGGGG + Intergenic
1034833665 7:154331902-154331924 AAATACCCACCTGTGGAATGTGG + Intronic
1034884372 7:154787173-154787195 AAAAAGTAACCTATGCAGTATGG + Intronic
1036500078 8:9305708-9305730 AAATAACCATCTTTGGGGTAAGG - Intergenic
1046167436 8:110455119-110455141 AAAAGGCAACCTATGGAATAAGG - Intergenic
1046266749 8:111840252-111840274 AAAAAGCCATCTAAAGAGTATGG + Intergenic
1051004132 9:12321379-12321401 AAATAGCCATATATGGATAATGG - Intergenic
1061329462 9:129883284-129883306 AAAGAGCCACCTCTGGGGTCAGG - Intergenic
1186216306 X:7304960-7304982 AATTAGCCACCCACTGAGTAGGG + Intronic
1186317137 X:8383315-8383337 AAGTAGCCACCTCTGGACTGTGG - Intergenic
1186338172 X:8614707-8614729 AAATAGGCACATAAGGAGTTAGG - Intronic
1187261946 X:17693071-17693093 AACTAGCCTCCTTTGGAGAATGG - Intronic
1190751191 X:53363088-53363110 AAATAACCATGTATGTAGTAGGG - Intergenic
1191654902 X:63585994-63586016 AAATACCCACCCATGCAGTAAGG + Intergenic
1194546290 X:95239195-95239217 AAATGGCCACCCATGGAGGGAGG + Intergenic
1199164521 X:144655492-144655514 AAATAGTCACTTACTGAGTATGG - Intergenic