ID: 916130263

View in Genome Browser
Species Human (GRCh38)
Location 1:161606297-161606319
Sequence GCCCCACGGGAGCTCGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916130252_916130263 21 Left 916130252 1:161606253-161606275 CCTCCGTGGCCTCCAGCATCCGA 0: 2
1: 0
2: 1
3: 11
4: 152
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130254_916130263 12 Left 916130254 1:161606262-161606284 CCTCCAGCATCCGACAAGAAGCT 0: 2
1: 0
2: 0
3: 5
4: 97
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130253_916130263 18 Left 916130253 1:161606256-161606278 CCGTGGCCTCCAGCATCCGACAA 0: 2
1: 0
2: 0
3: 10
4: 142
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130256_916130263 2 Left 916130256 1:161606272-161606294 CCGACAAGAAGCTTCAGCCATGC 0: 2
1: 0
2: 1
3: 9
4: 144
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130255_916130263 9 Left 916130255 1:161606265-161606287 CCAGCATCCGACAAGAAGCTTCA 0: 2
1: 0
2: 1
3: 4
4: 104
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916130263 Original CRISPR GCCCCACGGGAGCTCGCGGT GGG Intronic
900463719 1:2813556-2813578 GCCCCACGGGAGCCCACAGTGGG - Intergenic
902876261 1:19342620-19342642 CCCCCACGTGTGCTCCCGGTCGG - Intronic
907442590 1:54488352-54488374 GCCCGAGCGGAGCGCGCGGTGGG + Intergenic
914754309 1:150554147-150554169 GCCACACTGGAGGTCGGGGTTGG - Intronic
916120499 1:161524665-161524687 GCCCCACGGGAGCTCGCGGTGGG + Exonic
916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG + Intronic
1076998505 11:310900-310922 GCCCCATGGGCGGCCGCGGTGGG + Intronic
1077000238 11:318859-318881 GCCCCATGGGCGGCCGCGGTGGG - Intergenic
1077442304 11:2574450-2574472 GCCGCACGGGGGCTGGAGGTGGG + Intronic
1078142080 11:8700046-8700068 GCCCCACGGGAGCTGGCCTGGGG + Intronic
1079076752 11:17389221-17389243 GCCGCCCGGGCGCTCGCGGCTGG + Intronic
1084154052 11:67303963-67303985 GCTCCACGGGGCCTCCCGGTGGG + Intronic
1084563965 11:69919260-69919282 GGCTCACAGGAGTTCGCGGTGGG - Intergenic
1084642474 11:70434109-70434131 GCCACACGGGAGCTGGCGGCCGG - Intronic
1089243209 11:117098672-117098694 CCCCTCCGGGAGCTGGCGGTGGG + Intergenic
1089302029 11:117504608-117504630 GCCCCAGGGGAGGGTGCGGTAGG + Intronic
1094605602 12:31946425-31946447 GCACCTCGGGAGGTCGAGGTGGG + Intergenic
1095947119 12:47759561-47759583 GCCACCAGGGAGCGCGCGGTAGG - Intronic
1096180405 12:49547593-49547615 GCCCCACAGGAGCTCCCTGAGGG - Intronic
1104858677 12:131913738-131913760 GCCCCACAGGAGCTCACTGGTGG + Exonic
1115257755 14:31420633-31420655 GCACCGCGGGAGCTAGCGATTGG + Intronic
1122355909 14:101122739-101122761 GGCCCAAGGGAGCCTGCGGTGGG + Intergenic
1127830687 15:62748427-62748449 GCCCTGCGGGAGCTCGAGGTAGG + Exonic
1127960105 15:63884551-63884573 GCCCCACGGAAGCTTGCTCTTGG + Intergenic
1131109547 15:89756442-89756464 GCCCCAAGGGAACATGCGGTTGG + Intergenic
1131257018 15:90869728-90869750 GCCCCAGGGGAGCCCGCAGTGGG - Intronic
1132589557 16:720762-720784 GCCCCACGCGAGCCCCCGGCTGG + Intronic
1132879539 16:2155894-2155916 GCGCCTCGGGACCGCGCGGTGGG + Intronic
1132994609 16:2816765-2816787 GCCCAGCGGGAGCCCGCAGTGGG + Intergenic
1136910835 16:34142823-34142845 GTCCCACCGGAGTCCGCGGTGGG + Intergenic
1137528540 16:49261026-49261048 GTCCCACGGGATCTCGGGGGAGG - Intergenic
1142203946 16:88773856-88773878 GCCCCACCGGAGCTTGCTCTGGG + Intronic
1142799882 17:2338105-2338127 GCGCCGCGGGAGCTCGCGCGGGG - Intronic
1148899539 17:50865942-50865964 GGCCCTCGGGAGCTCGGGGACGG - Intronic
1151433636 17:74081146-74081168 GCCCCACAGCACCTCGGGGTGGG + Intergenic
1151681573 17:75625370-75625392 GCACCAGAGGAGCTCGGGGTGGG - Intergenic
1151693196 17:75700064-75700086 GCACCACGGGACATGGCGGTGGG - Intronic
1152924692 17:83081461-83081483 GCCCGAAGGGAGGGCGCGGTAGG + Intronic
1158452729 18:57581279-57581301 GCCCCACAGGAGGTGGCAGTGGG + Intronic
1159472905 18:68880071-68880093 GCCCCACGGGAGCCCATGGAGGG + Intronic
1160089469 18:75812753-75812775 GCCCCAAGGGGGCTTGGGGTGGG - Intergenic
1161357596 19:3827563-3827585 GCCCAACGGGAGCCCGCGCGGGG - Exonic
1162707895 19:12569263-12569285 GCCCCTCGGGAGGCCGTGGTGGG - Intronic
927931733 2:27049983-27050005 GGCCCACGTGAGGTCGGGGTCGG - Intronic
928617904 2:33057502-33057524 GCCGCACAGGAGCCCACGGTGGG + Intronic
929890830 2:45917746-45917768 GCCGCACGGGAGCTCACGGTCGG + Intronic
932453524 2:71831472-71831494 GCACCACGGGAGCAGGCTGTAGG + Intergenic
939538972 2:143469490-143469512 GGCCCACTGGAGCTCGCGTGTGG - Intronic
941934023 2:170969399-170969421 GCCCTAAGGGAGCTCACAGTAGG + Intergenic
944412034 2:199455900-199455922 GCCCCATGGGAGCCCGCGGGAGG - Exonic
945386624 2:209209359-209209381 GCCGCACTGGAGCTCCGGGTTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
948804744 2:240448604-240448626 GGCCCACAGGAGGTCGAGGTCGG + Intronic
1171770454 20:29319232-29319254 GTCCCACCGGAGTCCGCGGTGGG + Intergenic
1171770602 20:29319854-29319876 GCCCCACTGAAGAACGCGGTGGG - Intergenic
1171813168 20:29762029-29762051 GTCCCACCGGAGTCCGCGGTGGG + Intergenic
1172431816 20:34898876-34898898 GCCGCACAGGAGCCCACGGTGGG + Intronic
1175429354 20:58891188-58891210 GCCCCCCGGGAGCCCGGGGAGGG - Intronic
1179537521 21:42062035-42062057 TCCCCACGTGAACTCGCGGCAGG + Intergenic
1179913289 21:44461227-44461249 GCCCCACAGGAGCTGGCTGGAGG + Exonic
1180061779 21:45388954-45388976 ACCCCACTGGAGCTCGCTCTCGG + Intergenic
1180061790 21:45389029-45389051 ACCCCACTGGAGCTCGCTCTCGG + Intergenic
1181026264 22:20129525-20129547 GCCCCACGGGACCACAGGGTAGG + Intronic
1184460159 22:44633330-44633352 GACCCAGGGGAGCTCACGGTGGG - Intergenic
957084932 3:75669838-75669860 GTCCCACCGGAGTCCGCGGTGGG + Intergenic
958641941 3:96815262-96815284 GTCCCACGGCCGCTAGCGGTGGG - Intronic
963914033 3:150841305-150841327 GCCCCACTGGAGCTCTCTGCAGG + Intergenic
968025912 3:195442611-195442633 GCCCCTCGGGAGGGCTCGGTGGG + Intronic
974839753 4:67286771-67286793 GCCACACGGGAGCCCACGGCGGG + Intergenic
977400118 4:96521411-96521433 GGCCCACGGGAGCCCACGGCGGG - Intergenic
984918147 4:184741490-184741512 GCCGCACAGGAGCCCACGGTCGG - Intergenic
985660804 5:1155769-1155791 GCCCGGCGGGGGCTCGGGGTGGG + Intergenic
987696663 5:21341723-21341745 GGCGCGCGGGAGCCCGCGGTTGG - Intergenic
988755543 5:34244847-34244869 GGCGCGCGGGAGCCCGCGGTTGG + Intergenic
995193169 5:109340886-109340908 GCACCTCGGGAGGTCGAGGTTGG - Intronic
1001826688 5:174751197-174751219 CCGCCCCGGGAGCTCGCGGCGGG - Intergenic
1002701640 5:181128844-181128866 GTGCCACGGGTGCTCGTGGTGGG + Intergenic
1003178514 6:3771877-3771899 GCCACGCGGGAGCCCGCGGCGGG - Intergenic
1003812790 6:9803582-9803604 GCCCCTCGGGAGGCCGAGGTGGG - Intronic
1006509887 6:34515966-34515988 GGCCCACAGGAGTTCACGGTGGG + Intronic
1007536662 6:42597347-42597369 GCCCTATGGGAGGTCGAGGTGGG + Intronic
1015976398 6:138795862-138795884 GCCTCCAGGGAGCTTGCGGTGGG - Intergenic
1020252825 7:6483594-6483616 CCCCCACGGGAGATCCCGGCCGG + Intronic
1023921560 7:44634073-44634095 GCTCCAAGGGAGCTGGCAGTGGG - Intronic
1024733146 7:52274434-52274456 GCCCCACGGGAGCGTGCTGTGGG - Intergenic
1026458905 7:70596253-70596275 GCTCCGCGGGAGCTCCCGGGCGG - Intronic
1029222935 7:99004470-99004492 GCCCCATGGGAGCTCCAGGGTGG + Intronic
1029903996 7:104072046-104072068 GCCGCACAGGAGCCCACGGTGGG - Intergenic
1032096057 7:128939016-128939038 GCCCCAGCGGAGCACGCGGGAGG + Intronic
1032525652 7:132576975-132576997 GCCCCCCGGCAGCCCGCGGCCGG + Exonic
1049622951 8:143606759-143606781 GGTCCACGTCAGCTCGCGGTGGG + Intronic
1060140112 9:121202049-121202071 GCCCCACGGGCGCTCGCGCCCGG + Intronic
1061682466 9:132249863-132249885 GCCCTCCCGGAGCTCCCGGTGGG + Intergenic
1062230373 9:135479206-135479228 GCCCCACCCGAGCTTGCGGCGGG - Intronic
1190283119 X:48944342-48944364 GCCTCTCGGGAGCTTGAGGTCGG - Intronic
1193898429 X:87144277-87144299 GCCCTTTGGGAGCTCGAGGTGGG + Intergenic
1198060952 X:133044664-133044686 GCCACACAGGAGCCCACGGTGGG - Intronic
1200126763 X:153818949-153818971 GCCCCACGGGCAGTCGCTGTGGG + Intronic
1201178205 Y:11322466-11322488 GTCCCAGGGGAGTCCGCGGTGGG + Intergenic