ID: 916130263

View in Genome Browser
Species Human (GRCh38)
Location 1:161606297-161606319
Sequence GCCCCACGGGAGCTCGCGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916130253_916130263 18 Left 916130253 1:161606256-161606278 CCGTGGCCTCCAGCATCCGACAA 0: 2
1: 0
2: 0
3: 10
4: 142
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130252_916130263 21 Left 916130252 1:161606253-161606275 CCTCCGTGGCCTCCAGCATCCGA 0: 2
1: 0
2: 1
3: 11
4: 152
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130255_916130263 9 Left 916130255 1:161606265-161606287 CCAGCATCCGACAAGAAGCTTCA 0: 2
1: 0
2: 1
3: 4
4: 104
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130256_916130263 2 Left 916130256 1:161606272-161606294 CCGACAAGAAGCTTCAGCCATGC 0: 2
1: 0
2: 1
3: 9
4: 144
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88
916130254_916130263 12 Left 916130254 1:161606262-161606284 CCTCCAGCATCCGACAAGAAGCT 0: 2
1: 0
2: 0
3: 5
4: 97
Right 916130263 1:161606297-161606319 GCCCCACGGGAGCTCGCGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916130263 Original CRISPR GCCCCACGGGAGCTCGCGGT GGG Intronic