ID: 916134871

View in Genome Browser
Species Human (GRCh38)
Location 1:161642765-161642787
Sequence ATGTGTTATGGGAAGGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 2, 1: 0, 2: 6, 3: 70, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916134864_916134871 25 Left 916134864 1:161642717-161642739 CCTCCCAGACTTGCAAGTTTTTA 0: 2
1: 0
2: 1
3: 6
4: 219
Right 916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG 0: 2
1: 0
2: 6
3: 70
4: 432
916134866_916134871 21 Left 916134866 1:161642721-161642743 CCAGACTTGCAAGTTTTTAAAGT 0: 2
1: 0
2: 0
3: 18
4: 226
Right 916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG 0: 2
1: 0
2: 6
3: 70
4: 432
916134865_916134871 22 Left 916134865 1:161642720-161642742 CCCAGACTTGCAAGTTTTTAAAG 0: 2
1: 0
2: 3
3: 38
4: 696
Right 916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG 0: 2
1: 0
2: 6
3: 70
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916134871 Original CRISPR ATGTGTTATGGGAAGGATAC TGG Intronic
900358695 1:2277347-2277369 ATGTGTTGTGGGAGGGACCCAGG + Intronic
900749569 1:4386511-4386533 ATGCATTGTTGGAAGGATACTGG + Intergenic
901767544 1:11513025-11513047 ATGTGTTGTGGGAGGGACCCAGG - Intronic
901896133 1:12313810-12313832 ATGGGTCATGGGAATGATAACGG + Intronic
902060597 1:13638888-13638910 ATGTGTTATGGGAAGGCTAATGG + Intergenic
902634785 1:17728169-17728191 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
903006498 1:20302357-20302379 ATGTGTCATGGGGTGGATATAGG - Intronic
906096470 1:43227611-43227633 ATATGTTCTGGGAAGCAAACAGG + Intronic
906459337 1:46025423-46025445 ATGTGTTGTGGGAAGGGACCTGG - Intronic
906502965 1:46355353-46355375 ATGGGTTAGGGCAAGGATTCTGG + Intronic
907941029 1:59087563-59087585 ATGTGTTGTGGGAGGGATGCAGG - Intergenic
908535651 1:65074534-65074556 ACGTGTTAGGGGAAGGAAATGGG - Intergenic
908624930 1:66029308-66029330 ATGTGTTGTGGGAGGGACTCAGG - Intronic
909681395 1:78295371-78295393 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
910236011 1:85037317-85037339 ATGTGTAATGGGAGGTAAACTGG + Intronic
910628741 1:89336011-89336033 ATGTGTTCTGGGAGGGACAAAGG + Intergenic
910668071 1:89745507-89745529 ATGTGATATGGGAGGGATATAGG - Intronic
910774405 1:90861125-90861147 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
910792220 1:91063446-91063468 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
910818045 1:91312831-91312853 ATGTGTTGTGGGAGGGACCCAGG + Intronic
911173445 1:94795054-94795076 GTGTGTTTTGGGAAAGATAATGG - Intergenic
912099057 1:106183805-106183827 ACGTGTTATGGGAGGGACCCAGG + Intergenic
915101779 1:153506285-153506307 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
915202417 1:154241723-154241745 ATATGTTATATGAAGGAGACTGG + Intronic
915732936 1:158066996-158067018 ATGTTTTATGGGAAGGACAATGG - Intronic
915784787 1:158597713-158597735 ATGTGTCATGGGAGGGACCCAGG - Intergenic
916124977 1:161561420-161561442 ATGTGTTATGGGAAGGATACTGG + Intergenic
916134871 1:161642765-161642787 ATGTGTTATGGGAAGGATACTGG + Intronic
916533544 1:165681095-165681117 ATGTGTTGTGGGAGGGACCCAGG - Intronic
917340712 1:173974724-173974746 ATAGATCATGGGAAGGATACTGG + Intronic
917998880 1:180471710-180471732 ATGTGTTGTGGGAGGGACCCAGG - Intronic
919013321 1:191993584-191993606 ATGTGCAATGGGAACAATACAGG + Intergenic
919200543 1:194349704-194349726 ATGTGTTGTGGGAGGGACACAGG + Intergenic
921412150 1:214847015-214847037 ATGTGTGAGAGGAAGAATACTGG + Intergenic
923279540 1:232429850-232429872 ATGTGTTTTGGGAAAGATGCGGG + Intronic
923918971 1:238542535-238542557 ATATGTTATGGTAAGAATGCAGG - Intergenic
923919522 1:238547524-238547546 ATGTGTTGTGGGAGGGACACAGG - Intergenic
924131635 1:240915267-240915289 AGGTGCAATGGGAAGGATAGAGG - Intronic
924272154 1:242345068-242345090 ACGTGTTGTGGGAAGGACCCAGG - Intronic
1062808274 10:441492-441514 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1063049233 10:2428252-2428274 ATGTATTATTGGGAGGAAACAGG + Intergenic
1063311527 10:4956911-4956933 ATGTGATATGGACAGGAGACAGG - Intronic
1063316266 10:5009556-5009578 ATGTGATATGGACAGGAGACAGG + Intronic
1063505676 10:6596951-6596973 GTGTATCATGGGAAGGTTACTGG - Intergenic
1064133768 10:12732681-12732703 ATGTGTTGTGGGAGGGACAGGGG - Intronic
1064635985 10:17367423-17367445 ATGTGTTGTGGGAAGGACCTGGG - Intronic
1065347602 10:24764194-24764216 CTGTGTTATGGGAGGGACCCAGG - Intergenic
1065612855 10:27489525-27489547 ATGTGTTATGGGAGGGACCCCGG - Intergenic
1066712515 10:38251071-38251093 ACGTGTTGTGGGAAGGACCCAGG + Intergenic
1067302734 10:45027386-45027408 ATATGTTAGGAGAAGGATATTGG + Intergenic
1067548947 10:47219772-47219794 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1067956247 10:50794898-50794920 ATGTGTTGTGGGAAGGACCCAGG + Intronic
1069069727 10:63980896-63980918 ATGTGTTGTGGGAAGGACCTAGG + Intergenic
1069804279 10:71108145-71108167 ACGTGTTATGGGAGGGACACAGG + Intergenic
1070109221 10:73466386-73466408 ATGTAATATGGGAAGGATGGAGG - Intronic
1070403538 10:76074776-76074798 ATGTGTTATGGAAAGAATATTGG + Intronic
1070651995 10:78244039-78244061 ATGTGTTTTGGGAGGGACCCAGG + Intergenic
1070841031 10:79488004-79488026 AGATCTTATGGGAAGGATAGGGG + Intergenic
1071008841 10:80913948-80913970 GTGTGTTGTGGGAAGGATTAAGG + Intergenic
1072182846 10:93004869-93004891 ATGTGTTATGGGAAAAATTTAGG - Intronic
1072411203 10:95203639-95203661 ATGTGAGAAGTGAAGGATACTGG + Intronic
1074321469 10:112407154-112407176 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1075509144 10:123055398-123055420 ATGTGTTGTGGGAGGGACCCGGG - Exonic
1075543538 10:123336534-123336556 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1076760244 10:132600906-132600928 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1078553793 11:12301205-12301227 ATGTGTTGTGGGAAGGACCCAGG - Intronic
1078946156 11:16070840-16070862 AAGTGTGATGGGAGGGATATAGG - Intronic
1078974788 11:16461200-16461222 ATATGTTATGGGAAGCAAAAGGG - Intronic
1079925844 11:26490100-26490122 ATGTGTTATGGGAGGGACCAAGG + Intronic
1080987381 11:37485093-37485115 ATGTGTTGTGGGAATGACCCAGG + Intergenic
1081480062 11:43477664-43477686 ACGTGTTGTGGGAAGGACCCAGG - Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083199039 11:61108640-61108662 CTGTGTTTTGGGTAGGATTCTGG - Intronic
1084942944 11:72623570-72623592 ATGTGTTAAGGGAAGCATCCAGG - Intronic
1085142781 11:74163464-74163486 ATGTGTCATGGGAAGGACCGGGG + Intronic
1085751369 11:79164661-79164683 GTGTGTTATGGGAGGGACACAGG + Intronic
1085990723 11:81840122-81840144 ATGTGTTATGGGAGGAATCCAGG - Intergenic
1086182167 11:83965572-83965594 ATCTGTTATGTCAAGGATACTGG - Intronic
1088033491 11:105281256-105281278 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1089204443 11:116748131-116748153 TTCTGTTTTGGGAAGAATACAGG - Intergenic
1090554189 11:127855947-127855969 ATGTGATATGGACAGGAGACAGG - Intergenic
1091065553 11:132508572-132508594 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1091291855 11:134444949-134444971 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1091858737 12:3759800-3759822 ACGTGTTATGGGAGGGACCCAGG + Intronic
1091878656 12:3958757-3958779 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1092093480 12:5823036-5823058 ATGTGTTGTGGGAGGGACACAGG - Intronic
1092325638 12:7528279-7528301 ACGTGTTATGGGACGGACCCAGG + Intergenic
1092459335 12:8672631-8672653 ATGTGTCATGGGAGGGACTCAGG - Intergenic
1092799679 12:12152065-12152087 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1093233377 12:16576174-16576196 CTGTGTTATAGAAAGGCTACCGG - Intronic
1093483143 12:19625790-19625812 ACGTGTTGTGGGAAGGACCCAGG + Intronic
1093962738 12:25293020-25293042 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1094112155 12:26873509-26873531 ATGGGGAATGGGAAAGATACAGG + Intergenic
1095686051 12:45035119-45035141 ATGTGTTTTGGGAATGGTTCAGG - Intronic
1096737988 12:53671044-53671066 ATGTGTTCAGGGAAAGTTACTGG - Intronic
1097707733 12:62885188-62885210 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1097999236 12:65922773-65922795 ATGTGTTGTGAGAAGGACCCAGG + Intronic
1098001128 12:65944514-65944536 AAGTGTAAGGGGAAGGATCCAGG + Intronic
1098020063 12:66145388-66145410 ATTTGTTTGAGGAAGGATACAGG + Intronic
1098552377 12:71777041-71777063 ATCAGTTAAGTGAAGGATACAGG - Intronic
1098837568 12:75440902-75440924 ATGTGTTCTGGGAGGGACCCAGG + Intergenic
1099162244 12:79257237-79257259 TTATGGTATGAGAAGGATACAGG - Intronic
1099700199 12:86074007-86074029 ATGTGTCATGGGAGGGATCGGGG + Intronic
1099846317 12:88032300-88032322 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1100709216 12:97236470-97236492 ATGTGTTCTTGGAGGTATACTGG + Intergenic
1101334164 12:103781564-103781586 ATGGCTGATGGGAAGGATGCAGG - Intronic
1101413831 12:104491775-104491797 AAGTGTTTTGAGAAGGGTACTGG - Intronic
1101568629 12:105933157-105933179 GTGTGCTCTGGGAGGGATACTGG + Intergenic
1102148849 12:110674556-110674578 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1102211586 12:111131328-111131350 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1102249158 12:111374256-111374278 ATGTGTTGTGGGAGGGACCCTGG - Intergenic
1102794851 12:115679725-115679747 AAGTGTTGTGGGAGGGACACAGG + Intergenic
1103028926 12:117596340-117596362 ATGTGTCATGGGAGGGACCCGGG - Intronic
1104058509 12:125248701-125248723 ATTTTTTGTGGGAAGGAGACTGG + Intronic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1106262175 13:28077540-28077562 ACGTGTTGTGGGAAGGACCCAGG - Intronic
1106917475 13:34530508-34530530 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1108100328 13:46947500-46947522 AAGAGTTATGGGAAGGAGAAAGG + Intergenic
1108175620 13:47790010-47790032 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1108585322 13:51865797-51865819 ATGCCTTATGGGAAAGAGACCGG + Exonic
1109143753 13:58750619-58750641 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1109482590 13:62974991-62975013 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1110110687 13:71741992-71742014 ACATGTTGTGGGAAGGATGCAGG + Intronic
1110449586 13:75626471-75626493 ATGTGTTCTGGGAGGGACCCAGG - Intronic
1110453139 13:75659642-75659664 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1110713731 13:78677965-78677987 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1111863780 13:93742437-93742459 ATGTTTCAAGGGAAGGTTACAGG + Intronic
1112074022 13:95888548-95888570 ATATGTAATAGAAAGGATACAGG + Intronic
1112968162 13:105224959-105224981 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1112973551 13:105289409-105289431 ACGTGTTATGGGAGGGACCCAGG - Intergenic
1113190691 13:107742383-107742405 ATGTGTCCTGGGAAGGACCCAGG + Intronic
1113728322 13:112622377-112622399 GCGTGTGATGGGAAGGACACAGG - Intergenic
1115021400 14:28684984-28685006 ATGTGTTGTGGGAGGCATCCAGG + Intergenic
1115763412 14:36598206-36598228 ATGTGTGATTGGCAGGAGACAGG - Intergenic
1115903427 14:38180093-38180115 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1116400466 14:44500271-44500293 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1118064046 14:62171255-62171277 ACGTGTTATGGGAGGGACCCAGG - Intergenic
1118401098 14:65380325-65380347 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1118629423 14:67689216-67689238 CTGTGAGATGGGAAGGAAACTGG - Intronic
1120366870 14:83582444-83582466 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1120753740 14:88222254-88222276 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1121881747 14:97507092-97507114 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1121882010 14:97508987-97509009 ACGTGTTGTGGGAGGGATCCAGG + Intergenic
1123795397 15:23765715-23765737 ACATGTTGTGGGAAGGATCCAGG + Intergenic
1126994664 15:54427211-54427233 ATGTGTTGTGGGAAGGACCCAGG + Intronic
1127145146 15:56015816-56015838 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1127576128 15:60294462-60294484 ATGTGTTGTGGGAAGGACCTAGG - Intergenic
1127676246 15:61242052-61242074 ATGTGTTGTGGGAAGAACATGGG - Intergenic
1130173508 15:81543432-81543454 ATGTGTGATGGAAATGACACAGG + Intergenic
1130844002 15:87727122-87727144 CTGGGTCATGGGAAGAATACAGG - Intergenic
1131647824 15:94364348-94364370 ATGTCTTATGGGTAGGGTACAGG - Intronic
1132065291 15:98725952-98725974 ATGTGTTATGGGAAGGACCCAGG - Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133952960 16:10413231-10413253 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1134768417 16:16782768-16782790 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1138225627 16:55292051-55292073 ACGTGTTGTGGGAGGGATCCGGG - Intergenic
1138956546 16:61977719-61977741 ATGTCTTATGGGAATGCTATGGG - Intronic
1139085294 16:63577436-63577458 ACATTTTATGGGAATGATACGGG + Intergenic
1139172678 16:64650210-64650232 ATGTGTCATGGAAGGGATCCAGG - Intergenic
1140256623 16:73342540-73342562 ATGTGTTGAGGGAAGAAAACGGG + Intergenic
1140750126 16:78015849-78015871 ATGTCTGATGGGAAGGAGCCAGG + Intergenic
1142523023 17:518370-518392 CTGTGTTATGAGAAGGAGTCTGG - Exonic
1143847650 17:9785369-9785391 ATGTCTTATGGGCAAGATCCTGG + Intronic
1145957046 17:28861774-28861796 GTGGGTTATGGGAAGGGGACTGG + Intergenic
1147424863 17:40341713-40341735 GTGTGTTAAGGGGAGGACACCGG + Intronic
1147518323 17:41143180-41143202 ACGTGTCATGGGAAGGACACAGG - Intergenic
1149234747 17:54577187-54577209 TTGTGTTTTGAGAAAGATACCGG + Intergenic
1150941326 17:69697555-69697577 ACATGCTATGGGAAGGATCCAGG - Intergenic
1150941617 17:69699482-69699504 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1150977984 17:70110249-70110271 ATTAGATATGGGAAGGATAGGGG - Intronic
1153012137 18:548795-548817 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1153134451 18:1898376-1898398 AAGTGTTATGGGAAGGTAAGAGG + Intergenic
1153552850 18:6280565-6280587 ATGTGTGATAGGTAGGATAACGG + Intronic
1154217281 18:12424274-12424296 AAGTCTGATGGGAAGGAAACAGG + Intronic
1154313022 18:13282142-13282164 ACGTGTTATGGGAGGGACCCAGG - Intronic
1155843033 18:30669346-30669368 ATGTGTGATGGGAGGGACCCAGG - Intergenic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1157377962 18:47183204-47183226 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1157738835 18:50074281-50074303 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1158550810 18:58434288-58434310 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1159163670 18:64675766-64675788 ATTTATCATGGGAAGGATAAAGG - Intergenic
1159652696 18:70996503-70996525 ATGTGTTGTGAGAGGGACACAGG + Intergenic
1160601804 18:80019440-80019462 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1161499387 19:4605291-4605313 AAGTGTTTTGGGGAGGACACAGG - Intergenic
1162596339 19:11632480-11632502 AGGTGTTATGGGAGGGACCCAGG + Intergenic
1164209864 19:23089458-23089480 ATGTGTTATGGGAGGGACCGGGG + Intronic
1164494950 19:28751235-28751257 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1164841288 19:31394333-31394355 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1165974659 19:39665316-39665338 ATGTGTTAAGGGAGGGACCCAGG - Intergenic
1167087808 19:47322374-47322396 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1167144000 19:47671502-47671524 ATGTGTCATTGGGAGGAGACGGG + Intronic
1167403608 19:49289397-49289419 ACGTGTTATGGGAGGGAACCAGG + Intergenic
1168629213 19:57944111-57944133 ATGTGTGAGGGGAAGGATTATGG - Intronic
925067115 2:937307-937329 ACGTGTTTTGGGAGGGACACTGG - Intergenic
925257269 2:2500713-2500735 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
925805303 2:7642387-7642409 ATGTATTGTGGGAAGGACCCAGG - Intergenic
925805771 2:7646249-7646271 ATGTGTTATGGGAGGGAACCAGG - Intergenic
926869077 2:17392277-17392299 ATGTGTTATGGGAGGGACCCAGG + Intergenic
927288426 2:21380373-21380395 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
927888655 2:26734378-26734400 ATAAGTTATGGGAAGGCTACTGG - Intergenic
928395158 2:30938010-30938032 GTGTGTTATGGGAAGAATGTGGG - Intronic
928777265 2:34780727-34780749 ATGTGTTTTGGGAAGGACCCAGG - Intergenic
928897883 2:36285419-36285441 ATGGGTTATTGCAAGGATAGGGG - Intergenic
928927525 2:36594607-36594629 ACGTGTTGTGGGAGGGATCCAGG - Intronic
928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG + Intronic
929134466 2:38609769-38609791 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
929292454 2:40209128-40209150 ATGTGCTATGGAAAGAGTACAGG + Intronic
931202832 2:60116773-60116795 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
932904275 2:75733094-75733116 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
932976324 2:76603543-76603565 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
933156962 2:78986693-78986715 ACGTGTTGTGGGAGGGACACAGG - Intergenic
935608490 2:104995460-104995482 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
935626128 2:105173701-105173723 ATATGTTGTGGGAAGGACCCAGG - Intergenic
935748571 2:106210772-106210794 ATTTTTTATAGGAAGGCTACTGG - Intergenic
935927627 2:108087984-108088006 ATGTGTTATGGGAGGAACCCAGG + Intergenic
936844425 2:116813600-116813622 ATGACTTGAGGGAAGGATACAGG - Intergenic
938734705 2:134175683-134175705 AAGTATTATGGGAAGGGAACAGG - Intronic
938868721 2:135452271-135452293 ATGTGTTGTGGGAGGGACCCAGG - Intronic
939272745 2:139960727-139960749 ATGTGTTGTGGGAGGGACCCGGG + Intergenic
939287573 2:140153472-140153494 ATGTGTTGTGGGAGGGACTCAGG - Intergenic
939450530 2:142367448-142367470 TTGTGATATGGGCAGGAGACAGG - Intergenic
939568830 2:143815901-143815923 ACGTGTTGTGGGAAGGACCCAGG - Intergenic
940405149 2:153292828-153292850 ATGTCTGATGGGAATTATACCGG - Intergenic
940462128 2:153978469-153978491 ATGTGTTGTGGGAGGGACCCTGG + Intronic
940728558 2:157362724-157362746 ATGTGTTATGGGAGGGGCCCAGG + Intergenic
942616681 2:177798248-177798270 ATATGTTAGGGGAAGCATAGAGG - Intronic
943251063 2:185522369-185522391 ATGTGTTGTGGGAAGGACCCAGG + Intergenic
944938027 2:204590005-204590027 ATATGAAATGGGAAGGATAATGG + Intronic
945030001 2:205654672-205654694 ATGTGTTATGGGAGTGAGACTGG + Intergenic
945670726 2:212799982-212800004 AATGGTTATGGGAAGGACACTGG - Intergenic
945720083 2:213408286-213408308 ATTTTTTATAGGAAGGCTACAGG - Intronic
947093792 2:226543475-226543497 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
947547156 2:231018385-231018407 ATAGGTTATGGGAAGGAGAGGGG - Intronic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1169596333 20:7203881-7203903 ATGTTTTATGGCAAGGAAAATGG - Intergenic
1169742654 20:8912167-8912189 ATGTGTCATGGGAGGGACCCAGG + Intronic
1170124572 20:12949198-12949220 AAGTTTTATGGGGTGGATACTGG - Intergenic
1170152041 20:13236383-13236405 ATGTGTTGTGGGAAGGACCCAGG - Intronic
1170385193 20:15808806-15808828 ATGTGTTAGGGTAGGGATATTGG - Intronic
1170395751 20:15923423-15923445 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1173545649 20:43895825-43895847 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1174454102 20:50637456-50637478 ATGAGTTATTTGAAGGATACGGG - Intronic
1174951168 20:55042466-55042488 ATGTGTTGTGGGAAGGACTCTGG + Intergenic
1175195235 20:57238918-57238940 ATGTGTTGTGGGAGGGACTCGGG - Intronic
1175641686 20:60635590-60635612 CTGTGTTAAGAGAAGGATACTGG - Intergenic
1177028629 21:15954260-15954282 ATGTGTCTTGGGAACGATTCTGG + Intergenic
1177118035 21:17109294-17109316 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1177118297 21:17111211-17111233 ATGTGTTGTAGGAGGCATACAGG - Intergenic
1177485158 21:21746829-21746851 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1177950208 21:27526557-27526579 ATGTGTCATGGGAGGGACCCTGG + Intergenic
1178207723 21:30488815-30488837 ATGTGTTGTGGGAGGGATCCAGG - Intronic
1178469172 21:32876327-32876349 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1182194193 22:28497506-28497528 ATGTGTTTTGGGGAGGATCCTGG - Intronic
1182541893 22:31047772-31047794 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1182889027 22:33800984-33801006 ATGTGTTGTGGGAGGGACCCGGG + Intronic
950031881 3:9859051-9859073 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
950190496 3:10973191-10973213 ACGTGTGATGGGAAGAATGCGGG + Intergenic
951746415 3:25982611-25982633 ATGTATTATGGGAAAGAAAGTGG - Intergenic
952029600 3:29125434-29125456 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
952195576 3:31072431-31072453 ATTTGTTGTGGGAGGGACACAGG + Intergenic
952715241 3:36473229-36473251 ATGTGTTGTGGGAAGGACCCAGG - Intronic
953186603 3:40643446-40643468 GTGTGTGATGGAAAGGAAACAGG - Intergenic
954602004 3:51877578-51877600 GGGTGTTATGAGAAGGATAAAGG + Intergenic
954766469 3:52922000-52922022 TGGTGTTATAGGAAGTATACAGG + Intronic
955651407 3:61198181-61198203 AAGAATTATTGGAAGGATACTGG + Intronic
956013762 3:64859260-64859282 ATGTGTTATGGGAAAGGCAAGGG + Intergenic
957206545 3:77205646-77205668 ATGTGATATGGAGAGGAGACAGG - Intronic
957762310 3:84573843-84573865 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
957988320 3:87598395-87598417 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
958548002 3:95580590-95580612 ATGTGTTATTGGCTGGATAATGG - Intergenic
958650765 3:96932956-96932978 ACTTGGTATGGGAAAGATACAGG + Intronic
958886407 3:99732587-99732609 ATGTGTCATGGGAGGGACCCAGG - Intronic
959367243 3:105476877-105476899 ATGTGTTGTGGGAGGGAGTCAGG + Intronic
959672329 3:108993125-108993147 TTATGTTATGGAAAGGATACAGG - Intronic
959695549 3:109245763-109245785 ATGTGTTGTGAGAGGGATCCAGG - Intergenic
962170661 3:133098344-133098366 ATGTGTTGTGGGAGGGACCCCGG - Intronic
963129913 3:141848492-141848514 GTGCGTTAGGGCAAGGATACTGG + Intergenic
963379169 3:144506701-144506723 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
963523642 3:146388340-146388362 ATTTGTTATGGGAATGTCACTGG + Intergenic
963593214 3:147289273-147289295 ATGTGTTATAGAAAGAACACTGG + Intergenic
963915513 3:150855715-150855737 ATTTGTCATAGGAAGGCTACGGG - Intergenic
964427532 3:156569072-156569094 ATGTGTTGTGGGAGGGACCCGGG + Intergenic
964588983 3:158340104-158340126 ATGTGTTGTGGGAGGGATCCAGG + Intronic
964647531 3:158974231-158974253 ATGTGTTGTGGGGAGGAGGCTGG - Intronic
964654410 3:159050996-159051018 ATGTGTTGTGGGAGGGACCCAGG + Intronic
964654682 3:159052875-159052897 ATGTGTTGTGGGAGGGACCCAGG + Intronic
965300017 3:166997268-166997290 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
966074817 3:175923804-175923826 ACGTGTTATGGGACGGACAGGGG - Intergenic
966434533 3:179868771-179868793 ATGCGTTATGGGAGGGAGAAAGG - Intronic
966733495 3:183169743-183169765 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
967379635 3:188843311-188843333 ATGTGAAGTGGGAAGGGTACTGG + Intronic
967417903 3:189239368-189239390 ATGTGTTGTGGGAGGGAACCAGG - Intronic
967551421 3:190800260-190800282 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
970148676 4:13066348-13066370 ACCTGCTATGGGATGGATACTGG + Intergenic
970218208 4:13780886-13780908 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
970357996 4:15276995-15277017 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
970426717 4:15952797-15952819 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
971051150 4:22864068-22864090 ATGTGTTATGGGAGGGATCCAGG + Intergenic
971260440 4:25052112-25052134 ATGTGTTATGGGAGGGACACAGG + Intergenic
971299321 4:25428824-25428846 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
971530206 4:27678314-27678336 ATGAGTTATGGGAAAGAAAGAGG - Intergenic
971830755 4:31691017-31691039 ATGTGTCATAAGGAGGATACTGG + Intergenic
972291632 4:37695227-37695249 ATGTGTCATGGGAGGGATCCAGG - Intergenic
972390322 4:38607407-38607429 AAGTGATATGGGAGGGGTACAGG - Intergenic
972856999 4:43119676-43119698 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
973168493 4:47109081-47109103 ATATGTTTTGGGTAGGATATGGG + Intronic
973664950 4:53149757-53149779 ATGGGTTCTGGGGAAGATACTGG - Intronic
973718297 4:53699633-53699655 ATGTGTTGTGGGAGGGACCCAGG - Intronic
974055020 4:56976317-56976339 ATTTGTAAAGGGAAGGGTACAGG + Intronic
974453922 4:62101613-62101635 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
974887478 4:67837646-67837668 ATGTGTTATATGATGGAGACTGG + Intronic
975205481 4:71639933-71639955 ATTTTTTATAGGAAGGCTACGGG - Intergenic
975919829 4:79371683-79371705 ATGTGTTGTGGGAGGGACTCGGG - Intergenic
975931496 4:79529268-79529290 ATGTGTTATGATATGGATACAGG + Intergenic
976335324 4:83878907-83878929 ATGTGTTGTGGGAGGGGTCCCGG + Intergenic
976405433 4:84657021-84657043 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
976411935 4:84723807-84723829 ATGTGTTAAGGTAGGGATAATGG + Intronic
977005156 4:91558794-91558816 ATGTGTTGTGGGAGGGACCCAGG - Intronic
977026224 4:91822075-91822097 ATGTGTTATGGGAGGGAACCAGG - Intergenic
978100936 4:104840607-104840629 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
978284356 4:107058063-107058085 ATGTGTTGTGGGAGGGACCCAGG - Intronic
978933734 4:114350288-114350310 AGATGTGATGGGAAGGGTACAGG - Intergenic
978934286 4:114356088-114356110 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
980432755 4:132725960-132725982 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
980478778 4:133357341-133357363 ATGTGTTGTGGGAGAGATCCAGG - Intergenic
981393429 4:144218191-144218213 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
982193080 4:152877711-152877733 ATGTGTTGTGGGAGGGACCCAGG + Intronic
982949041 4:161665008-161665030 ATGTGTTGTGGGAGGGACCCAGG - Intronic
984956969 4:185054417-185054439 ATGTGTTCAGGGAACGATGCAGG + Intergenic
985352571 4:189081536-189081558 ATGTGTTGTGGGAGGGATCCTGG - Intergenic
985970398 5:3373603-3373625 ATGTGTTGTGGGATGGAGGCTGG + Intergenic
986113753 5:4749455-4749477 ATGTGTTGTCGGAGGGACACAGG - Intergenic
986114080 5:4751766-4751788 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
986696401 5:10360054-10360076 TTATGTTATGGGAAGGCTTCTGG + Intronic
987333228 5:16875089-16875111 ATGTGTTGTGGGAGGGACCCAGG - Intronic
987663703 5:20908450-20908472 AAGTGTTGTGGGAAGGATCCAGG + Intergenic
988113330 5:26852001-26852023 AAGTGTTATGGGAGGAACACAGG + Intergenic
988128985 5:27079123-27079145 ATGTGTTGTGGGAGGGACCCTGG - Intronic
988758982 5:34293739-34293761 AAGTGTTGTGGGAAGGATCCAGG - Intergenic
988946303 5:36204402-36204424 ATTTTTTATGGTAAGAATACTGG + Intronic
989141207 5:38203291-38203313 AGGTGTTATTTGAAGGGTACTGG + Intergenic
989532403 5:42523777-42523799 ATGTGTTATGGGAGGCACCCAGG + Intronic
989637253 5:43549363-43549385 ATGTGTTGTGGGAGGGACCCAGG + Intronic
990126069 5:52518822-52518844 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
991291569 5:65037980-65038002 AGCTGTTCTGGGAAGGAGACAGG - Intergenic
992207872 5:74448596-74448618 TTGTGCTATGGGAAGGAGAAAGG + Intergenic
993088018 5:83387979-83388001 ATGAGTTATGGGAAGGAAAAAGG - Intergenic
993098123 5:83505050-83505072 ATGTGTTGTGGGAGGGACCCAGG - Intronic
993893858 5:93506737-93506759 ATGTGTTCTGGGAGGGACCCGGG - Intergenic
994590630 5:101768221-101768243 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
994900313 5:105761980-105762002 ATGTGTTATGGAAGGGACCCAGG - Intergenic
994920259 5:106033504-106033526 AAGTGTTGTGGGAGGGAAACAGG - Intergenic
995986804 5:118186445-118186467 ATGTGTTATGGCCAGGATCGGGG + Intergenic
996222666 5:120952659-120952681 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
996670437 5:126112087-126112109 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
997056818 5:130453259-130453281 ATGTGTTATGGGAGGGACCCAGG - Intergenic
997506443 5:134421389-134421411 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
997656562 5:135559502-135559524 ATGTGCTGGGGGAAGGATCCTGG + Intergenic
998144382 5:139718285-139718307 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
998576513 5:143323480-143323502 ATGTGTTGTGGGAGGGACCCGGG - Intronic
998576812 5:143325406-143325428 ATGTGTTGTGGGAGGGACCCAGG - Intronic
998722836 5:144974387-144974409 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
998723119 5:144976320-144976342 ACATGTTGTGGGAAGGATCCAGG + Intergenic
998889196 5:146728636-146728658 ATGTGTTGTGGGAGGGACCCAGG + Intronic
999669243 5:153944441-153944463 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
999924375 5:156359179-156359201 ATGTGTTATGAAAAGGAAACTGG + Intronic
1000226665 5:159267663-159267685 ATGTGTTATGAGAGGGACCCAGG + Intronic
1000315187 5:160083658-160083680 ATGTGTCATGGAAAGGGTTCGGG + Intronic
1001077555 5:168641833-168641855 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1001606165 5:172961276-172961298 ATGTCTGATGGGAAGGATCCAGG - Intronic
1003401904 6:5797502-5797524 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1003856506 6:10281359-10281381 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1004192023 6:13472174-13472196 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1004764877 6:18714871-18714893 ATGTGTTATGATAAAGACACAGG - Intergenic
1004889329 6:20084201-20084223 ATGTGATCTGGGATGGATTCTGG - Intergenic
1004899860 6:20184030-20184052 ACGTGTTATGTGAGGGACACAGG - Intronic
1004991256 6:21141043-21141065 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1005664796 6:28041618-28041640 TTGTGTGATGGGAAGGATCCTGG + Intergenic
1005905152 6:30255973-30255995 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1005906371 6:30264376-30264398 GTGTGTTCTGGGAAGAACACGGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007971593 6:46057213-46057235 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1008123298 6:47642093-47642115 ATTTTTTATTGGAAGGCTACAGG - Intergenic
1008500023 6:52171254-52171276 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1009537217 6:64903518-64903540 AAGTGATATGAGAAGGATAAAGG - Intronic
1009980631 6:70721902-70721924 ATGTGTTGTGGGAGGGATCCGGG - Intronic
1010148019 6:72694675-72694697 ATGTGTTATTGTCACGATACTGG + Intronic
1012365715 6:98437167-98437189 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1014488753 6:122035898-122035920 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1014770953 6:125457822-125457844 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1014771233 6:125459618-125459640 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1014817370 6:125950832-125950854 ACGTGTTGTGGGAAGGACCCAGG + Intergenic
1014863397 6:126497751-126497773 ATGTGTCATGGGAGGGACCCAGG - Intergenic
1015794082 6:136993367-136993389 ATGTGTTGTGGGAAGGACCCGGG - Intergenic
1015847906 6:137540547-137540569 TTGTGTTAAGGGAATGATAATGG - Intergenic
1016297326 6:142587243-142587265 ATGTGTTTTGGGAAGGAACCAGG + Intergenic
1016411033 6:143784911-143784933 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1016450809 6:144180421-144180443 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1017535288 6:155340850-155340872 ATCTGTTGTGAGAAGGAGACTGG + Intergenic
1017885568 6:158596889-158596911 ATGTGTTGTGGGAGGGACCCGGG - Intronic
1018541687 6:164887168-164887190 ATGTGTTTTGGGAGGGACCCGGG - Intergenic
1018842958 6:167531789-167531811 AAGTGATATGGGAAGGAGGCAGG + Intergenic
1018867060 6:167754463-167754485 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1019125424 6:169837520-169837542 ATGTGTAGTGGGAAGAATAATGG + Intergenic
1020906492 7:14070071-14070093 AGGTGTTGTGGGAAGGAACCAGG + Intergenic
1021656563 7:22879794-22879816 ACGTGTTGTGGGAAGGACCCAGG + Intergenic
1022549555 7:31226231-31226253 ATGTGTTGTGGGAAGGACCCAGG + Intergenic
1022678239 7:32520873-32520895 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1023606609 7:41937105-41937127 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1023627425 7:42129880-42129902 ATGTGCTGTGGGCAGGAGACAGG - Intronic
1027481734 7:78706191-78706213 ATGTGTTATGGGAGGGATCTGGG + Intronic
1027798208 7:82719873-82719895 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1027903444 7:84148937-84148959 CTGTGTTATGGTAAGGTTTCTGG + Intronic
1028138210 7:87244697-87244719 ACGTGTTATGGGAGAGATCCAGG + Intergenic
1028259490 7:88643959-88643981 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1028795393 7:94896175-94896197 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1030094062 7:105882273-105882295 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1030583535 7:111388794-111388816 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1031174903 7:118338040-118338062 ACGTGTTGTGGGAGGGATCCAGG + Intergenic
1031175177 7:118339952-118339974 ATGTGTTGTGGGAGGGATTCAGG + Intergenic
1031217928 7:118921494-118921516 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
1031884084 7:127227729-127227751 ATGTTTTCTGAGGAGGATACTGG - Intronic
1032007559 7:128315226-128315248 CTGTGTTATGGGAAGGGGAATGG - Intronic
1032362923 7:131272850-131272872 ATGTGTTGTGGGAGGGACCCGGG - Intronic
1032641294 7:133771830-133771852 ATGAGGTATGGGAGGGAAACAGG + Intronic
1033419875 7:141195980-141196002 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1033580169 7:142725920-142725942 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034320387 7:150174428-150174450 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034687675 7:152987518-152987540 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034772355 7:153792793-153792815 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1035539646 8:422880-422902 ATGTGTTACGGGAGGTACACAGG + Intronic
1035825288 8:2638461-2638483 ATGTGTTGTGGGAGGGACACAGG - Intergenic
1037647420 8:20805171-20805193 ATGTGTTGTTGGAAGGACCCAGG - Intergenic
1038139164 8:24823360-24823382 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1038214666 8:25550538-25550560 AAGTGTTGTGGGAAGGACCCGGG + Intergenic
1039071846 8:33656083-33656105 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1039373097 8:37006786-37006808 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1039433526 8:37544116-37544138 ATGTGGGCTGGGAGGGATACAGG - Intergenic
1039562134 8:38521046-38521068 ATGGGTTTTGGGCAGGACACTGG + Intronic
1039760430 8:40568785-40568807 ATGTGTATTGGGAATGAGACTGG - Intronic
1041079843 8:54205996-54206018 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1041818763 8:62004670-62004692 ACATGTTGTGGGAAGGATCCAGG + Intergenic
1043834904 8:85034684-85034706 ATGTGTTGTGGGAAGGACCCAGG - Intergenic
1044279571 8:90339919-90339941 ATGTGTTATGGGAGGGACCCAGG + Intergenic
1044324701 8:90846868-90846890 ATATGTCATGGGAGGGATCCAGG - Intronic
1044718412 8:95122745-95122767 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1044952956 8:97451435-97451457 CTGTGTTGTGGGAAGGTTACCGG - Intergenic
1046737958 8:117797363-117797385 ATGTGTTATGTGAAGAAAAATGG - Exonic
1047286479 8:123491662-123491684 ATGTGTTATGGGAGGGACCCAGG + Intergenic
1047303754 8:123636839-123636861 ACTTGTTATGGGAGGGTTACTGG + Intergenic
1047628184 8:126678038-126678060 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1048782821 8:138020754-138020776 ATGTGTTATGGGAGGGATCCAGG + Intergenic
1048923215 8:139249169-139249191 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
1048966350 8:139617703-139617725 ATGTGTGATGGGAAAGAAAACGG + Intronic
1050483344 9:6108549-6108571 ATGTGTAATGGGGATGATAATGG - Intergenic
1051205152 9:14680849-14680871 ATCTCATATGGTAAGGATACTGG + Intronic
1051276251 9:15401733-15401755 GTGTGTTACGGGAAAGACACAGG - Intergenic
1051493471 9:17692996-17693018 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1052397056 9:27950787-27950809 AAGTGTAATGGAAAGGATACTGG + Intronic
1052747979 9:32460004-32460026 ACGTGTTATGGGAGGGACCCAGG + Intronic
1053430969 9:38041497-38041519 ATGGGTGATGGGAAGGAGAAGGG + Intronic
1055165373 9:73185244-73185266 ATGTGGCATGGGAGGGATCCAGG + Intergenic
1055372948 9:75619888-75619910 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1056070877 9:82985415-82985437 ATGTGTTGTGGGAAGGACCCCGG - Intronic
1056363835 9:85883670-85883692 GTGTGCTGTGGGATGGATACTGG - Intergenic
1056433581 9:86553184-86553206 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1056638539 9:88350734-88350756 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1056851414 9:90087692-90087714 ATCTGTAATGGAAAGGATACAGG - Intergenic
1056953549 9:91065058-91065080 ATGAGTGATGGGGAGGAAACAGG - Intergenic
1058649189 9:107159230-107159252 CTGTGTTGTGGGAAGGACAGGGG + Intergenic
1059565709 9:115381508-115381530 ACATGTTGTGGGAAGGACACAGG - Intronic
1059587124 9:115618901-115618923 ATGTGTTATGGGAGGGACACAGG - Intergenic
1059671545 9:116496925-116496947 ATGTGTTATGGGAGGGACCCTGG - Intronic
1059716484 9:116917926-116917948 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1059783231 9:117551864-117551886 ATGGGTAAAGGGAAGGATTCTGG + Intergenic
1061686044 9:132279503-132279525 ATGAGTGATGTGAAAGATACTGG + Intronic
1061775321 9:132959170-132959192 ATGTGTCATGGTAGGGAAACTGG + Intronic
1185561561 X:1063937-1063959 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1185968412 X:4633701-4633723 ACGTGTTGTGGGAAGGAGCCAGG - Intergenic
1187388604 X:18871259-18871281 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1187989224 X:24851371-24851393 AGTTATTATGGGCAGGATACCGG - Intronic
1188588092 X:31801366-31801388 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1188765158 X:34081546-34081568 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1188877730 X:35451858-35451880 ACGTGTTGTGGGAGGGATCCAGG + Intergenic
1189371132 X:40430419-40430441 ATGTGTTGTGGGAAGGACCCAGG + Intergenic
1189378296 X:40482989-40483011 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
1189409312 X:40755790-40755812 ATCTGCTGTGGGAAGGAAACTGG + Intergenic
1192309539 X:69998586-69998608 ATGTGATATGGGAGGGATCAGGG + Intronic
1193797363 X:85892360-85892382 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1194501338 X:94685207-94685229 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1195062644 X:101211234-101211256 AAGTGTAATGGGAATGATTCAGG + Intergenic
1195480129 X:105335272-105335294 ATGTGTTAAGGGAAGGTATCTGG - Intronic
1195745938 X:108118351-108118373 ATGTATAGTGGGAAGAATACTGG + Intronic
1195838712 X:109148964-109148986 ATGTGTCATGGGAGGGACCCGGG + Intergenic
1195863567 X:109406674-109406696 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1196358235 X:114820582-114820604 ACGTGTTATGGGAGGGACCCAGG + Intronic
1196531653 X:116794742-116794764 ATGTGTATTGGAAAGGATAGGGG - Intergenic
1197091338 X:122541443-122541465 ATGTCATATTGGAAGGACACTGG - Intergenic
1197547210 X:127839507-127839529 ATGTGTTGTGGGAGGGACTCAGG - Intergenic
1197650817 X:129061467-129061489 ATGTGGTCTGGGAAGGCTTCTGG + Intergenic
1198626262 X:138579005-138579027 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
1198734462 X:139771114-139771136 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1198734747 X:139773034-139773056 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1198914567 X:141653915-141653937 ATGTGTTATGGGACACATAGAGG - Intronic
1199208681 X:145180391-145180413 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1199629268 X:149764885-149764907 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1200873732 Y:8129384-8129406 AAGTGTAGTTGGAAGGATACTGG + Intergenic
1201469293 Y:14316371-14316393 ATGTGTTATGGGATGGAAGTAGG + Intergenic
1201568211 Y:15388063-15388085 ATTTTTTATAGGAAGGGTACAGG + Intergenic
1202091244 Y:21193266-21193288 ATGTGTTGTGGGAGGGACTCAGG + Intergenic