ID: 916136104

View in Genome Browser
Species Human (GRCh38)
Location 1:161655434-161655456
Sequence AGAACTACCCTTCAAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916136104 Original CRISPR AGAACTACCCTTCAAATTGG AGG Intronic
901740916 1:11341235-11341257 AGAACTAACATTCTAATTAGAGG + Intergenic
906505790 1:46378653-46378675 TGAACCAACCTTCAAAGTGGTGG + Intergenic
908650154 1:66323981-66324003 TGAACATCCCTTCACATTGGTGG + Intronic
916126186 1:161573594-161573616 AGAACTACCCTTCAAATTGGAGG + Intergenic
916136104 1:161655434-161655456 AGAACTACCCTTCAAATTGGAGG + Intronic
917180183 1:172287703-172287725 GCAACAACCATTCAAATTGGAGG - Intronic
918572232 1:186010303-186010325 AGAACTATACTTCCATTTGGGGG - Intronic
919083768 1:192896008-192896030 AGAACTCCCTTTCATATTGTGGG - Intergenic
919392255 1:197001777-197001799 AACACTTCCCTTCAAAATGGTGG - Intronic
923388102 1:233485620-233485642 ATAACCACCCCTCTAATTGGTGG - Intergenic
924464595 1:244288647-244288669 CAAACTACTCTTCAAATTAGGGG + Intergenic
1065058612 10:21873514-21873536 AAAACTATCCTTCAAAATGAAGG + Intronic
1065112303 10:22452273-22452295 AGATTTACCCTTCAACTTGGTGG - Intronic
1068123013 10:52803930-52803952 AGTCCTCCCCTTCCAATTGGTGG + Intergenic
1068854359 10:61782275-61782297 GGAACTACCCATGAAACTGGAGG - Intergenic
1072765580 10:98092190-98092212 AGAACTTCTGTTGAAATTGGTGG + Intergenic
1073213278 10:101821757-101821779 AGAACCACTCTTCAAATTTGAGG - Intergenic
1076337539 10:129718462-129718484 AGAATTGCCCTTCGAAATGGAGG - Intronic
1076576221 10:131471114-131471136 AGAATTACCCTTCAAAAGTGAGG - Intergenic
1078629821 11:12992161-12992183 AGATCTGCCCTTGATATTGGTGG - Intergenic
1079458431 11:20657610-20657632 AAAACTTCCCTTCAAAGTGGGGG + Exonic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1087487633 11:98776613-98776635 AGAAATACCCTTGAAAATGATGG + Intergenic
1088837856 11:113593642-113593664 ACAAATACCCTTCCAATTTGGGG + Intergenic
1089812576 11:121143931-121143953 AGGACTACCCTTGAATTAGGGGG + Intronic
1092966035 12:13643660-13643682 AGAACTTCCTTCAAAATTGGAGG + Intronic
1093383523 12:18522861-18522883 TGAACTAACCTTCAAATAGTAGG - Intronic
1099177104 12:79434926-79434948 AGACCTACCTTTGGAATTGGGGG - Intronic
1099577649 12:84401926-84401948 AGAAATACCCTTAATCTTGGTGG + Intergenic
1101671176 12:106875012-106875034 AAAACTGCCCTTCAAATTTGGGG - Intronic
1104658855 12:130594290-130594312 AGAACTGTCCTTCAAAATGTGGG + Intronic
1109461388 13:62663382-62663404 AGAAATGCCCTTCTAACTGGTGG + Intergenic
1113873211 13:113577103-113577125 AAAACTACCCTTCAAAAACGAGG + Intergenic
1114233257 14:20802578-20802600 AGAAGGAGCCTCCAAATTGGGGG - Intronic
1115616512 14:35100428-35100450 AGAAATAGCCTTCACATTGCTGG - Intronic
1123408953 15:20042848-20042870 AGACCTACCCTTAATCTTGGTGG + Intergenic
1123518283 15:21049558-21049580 AGACCTACCCTTAATCTTGGTGG + Intergenic
1124420867 15:29520230-29520252 AGAACTATTCTTCAATTTGTAGG - Intronic
1125377439 15:39045632-39045654 AGAAAAACCCTTCTAATTGTTGG + Intergenic
1126788615 15:52199774-52199796 GAAACTTCCCTTCCAATTGGAGG + Intronic
1126791264 15:52223219-52223241 AGAGCTACCCTTCAATTTTGTGG + Intronic
1136365730 16:29808272-29808294 AGAACGGCCCTTCAAATGTGAGG + Exonic
1139036415 16:62952862-62952884 TAAACTACACTTCAAATTGTAGG - Intergenic
1139316445 16:66074534-66074556 AAAAATACCCTTCAAAATGATGG + Intergenic
1140852008 16:78943771-78943793 AGATTTCCCCTTCAAATTGTGGG - Intronic
1146255496 17:31389778-31389800 CGACCTACCCTGCAAAATGGAGG - Intergenic
1148771840 17:50071925-50071947 AGAACTATGCTGCATATTGGAGG + Intronic
1150855603 17:68749504-68749526 AAAGCTACCCTTCCAGTTGGTGG + Intergenic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1154003222 18:10504626-10504648 AAAACTATCCTTCAAAATGGAGG - Intergenic
1156333004 18:36143038-36143060 AAAACTATCCTTCACATAGGTGG - Intronic
926033523 2:9614472-9614494 AGAACTTTCCTTAAAATGGGGGG + Intronic
930837651 2:55811601-55811623 AGAAATACTTTTCAGATTGGTGG + Intergenic
934048024 2:88187946-88187968 AGAACTACACACCAAACTGGAGG - Intergenic
934172635 2:89553306-89553328 AGAATTACCCTTCCATTTGTGGG - Intergenic
934282948 2:91627658-91627680 AGAATTACCCTTCCATTTGTGGG - Intergenic
934918764 2:98323825-98323847 AAAACTAGCCTTCAAAATGAAGG + Intergenic
935003329 2:99043802-99043824 AGAACTACCTTTCAGAATGAAGG + Intronic
937800959 2:126079790-126079812 AGAACTACCCTTAATCTGGGTGG + Intergenic
940220597 2:151347449-151347471 AGAAGTACCCTTGAGATGGGGGG + Intergenic
940829829 2:158455612-158455634 GTTACTACCCCTCAAATTGGAGG - Intronic
940982213 2:160016530-160016552 AGAAATTCACTTCAAATTGATGG + Intronic
944791203 2:203128996-203129018 AGAACTACCCTTTAAGTTAGTGG + Intronic
947059810 2:226151066-226151088 TGAATTAACCTTCAAATTGTTGG + Intergenic
947687102 2:232097624-232097646 GGACTTACCCTTCAAAGTGGTGG + Intronic
1170354341 20:15475805-15475827 AGAATTACCCTTCAGATGGTAGG - Intronic
1170542131 20:17399961-17399983 AGAATTAACCTTCTCATTGGAGG + Intronic
1170567978 20:17617338-17617360 ACACCTGCCCTTCAAATTGCAGG - Intronic
1171619326 20:27026684-27026706 AAAACTGCCCTTCAAAACGGTGG - Intergenic
1179772249 21:43630634-43630656 AAAACTACCCTGAAGATTGGTGG + Intronic
1181318268 22:21985225-21985247 AGAGGAACCCTTCAACTTGGAGG + Intergenic
1182015456 22:27035612-27035634 AGAACTGCATGTCAAATTGGGGG - Intergenic
951549101 3:23858993-23859015 AAAACTACCAGCCAAATTGGGGG - Intronic
952917696 3:38261593-38261615 AGACCTAGCCTTCAACTTGTGGG + Intergenic
955190881 3:56760589-56760611 ACAACCACCCTGCAAGTTGGGGG + Intronic
958454548 3:94313655-94313677 AAAATTGCCCTTCAAAATGGTGG + Intergenic
958864606 3:99486178-99486200 AGAGATACCCTTCTAACTGGGGG + Intergenic
960462139 3:117949202-117949224 AGATCTACCATGCAAATGGGGGG - Intergenic
960567314 3:119147356-119147378 AGTACAACCCTGCAAATTTGAGG + Exonic
961315716 3:126034039-126034061 AGAAATGGCCTTCAAATTGCTGG - Intronic
963029849 3:140958727-140958749 GGAACTACATTTCTAATTGGCGG + Intronic
968047099 3:195630631-195630653 AGAACCTCTCTTCAAATAGGAGG - Intergenic
968307549 3:197659413-197659435 AGAACCTCTCTTCAAATAGGAGG + Intergenic
973685117 4:53362028-53362050 AGAACTTCCATTCAAGTGGGAGG + Intronic
975681690 4:76883793-76883815 AGAACTACTTTTCAAATTTTAGG - Intergenic
984172059 4:176370867-176370889 AGAACTACCCTGCAAAAAGGGGG + Intergenic
984180128 4:176472409-176472431 AGACCTACCCTTCATCTGGGTGG - Intergenic
986039242 5:3971659-3971681 AGACCTACCCTTAAACTGGGTGG - Intergenic
988694008 5:33601029-33601051 AGATCTACCCTTCATAATGAAGG + Intronic
993274956 5:85845109-85845131 AAAACTGCCCTTCATATTTGAGG - Intergenic
1004729968 6:18348020-18348042 AGAAGTACCTTTCAATTTGGTGG - Intergenic
1006895949 6:37471103-37471125 AGATCTTCCCTTGAAATAGGTGG - Intronic
1007407187 6:41641865-41641887 AGGACCACCCCTCAACTTGGTGG + Intronic
1010899437 6:81408133-81408155 AAAACTACACATCAAATTAGAGG + Intergenic
1010937881 6:81883460-81883482 AGACCTACCCTTCATCTGGGTGG - Intergenic
1011695462 6:89908442-89908464 AGAATTATCCTTCAAAGTGAAGG - Intergenic
1013897677 6:115110474-115110496 AAAACTTCCCATCAAATTGATGG + Intergenic
1014551814 6:122797834-122797856 AGACCTACCCTTCATTTTGTAGG + Intronic
1015028008 6:128560491-128560513 AGAACTGCCCTGCACATTGTAGG - Intergenic
1015392321 6:132696713-132696735 AGAACTGCCCTTCAAAAGGGAGG + Intronic
1016536289 6:145110315-145110337 AGCCCTGCCCTTCAAGTTGGAGG - Intergenic
1018025112 6:159799716-159799738 AGAACTGCCCATTAAATTGAAGG - Intergenic
1022404763 7:30078437-30078459 ATGACTACCCTTCTAATTTGTGG - Intronic
1023647474 7:42333041-42333063 AAAACTATCCTTCAAAATGAAGG + Intergenic
1032958053 7:136996046-136996068 AGAACCACATTTCAAATTTGTGG + Intronic
1033080403 7:138291260-138291282 AGAACTTCCTTCAAAATTGGAGG + Intergenic
1041369923 8:57148535-57148557 AGAAATACCCTTGAATTTGGTGG - Intergenic
1042272844 8:66972847-66972869 AGAAATTCACTTCAATTTGGTGG - Intronic
1043066477 8:75577698-75577720 AAAATTACCCTTCAAATGTGAGG + Intergenic
1045857738 8:106783214-106783236 AGTTCTGCCCTTCAAAGTGGGGG - Intergenic
1046463430 8:114571354-114571376 AGACCTACCCTTCAGCTGGGTGG + Intergenic
1049041014 8:140111688-140111710 AGAACTTTCCTTCAAAATGGAGG + Intronic
1057210650 9:93199297-93199319 AGGACTATCCTTGACATTGGGGG - Intronic
1057461559 9:95267377-95267399 AGAACTAGCTTTCACAGTGGGGG - Intronic
1058310453 9:103495397-103495419 AGAAGTCTCCTTCAAATTGTTGG - Intergenic
1058360128 9:104135826-104135848 AGAAATATTCTTCAAATTGAAGG + Intronic
1058803368 9:108566531-108566553 AAAACTACCTTTCAAATGTGTGG + Intergenic
1060402980 9:123358882-123358904 AAAATTTCCCTTGAAATTGGGGG - Intronic
1185520653 X:736200-736222 AGGCCTTCCCTTCTAATTGGGGG - Intergenic
1185610475 X:1391500-1391522 AGAATTACCCTTCACGGTGGAGG + Intronic
1186684114 X:11906454-11906476 AAAACTACCTTTGAAAATGGAGG - Intergenic
1191810914 X:65187238-65187260 TGAATTGCCCTTCACATTGGTGG + Intergenic
1192193323 X:69010795-69010817 AGATCTACCCTTAAAAATTGTGG - Intergenic
1195945616 X:110207626-110207648 AGAATTGCTTTTCAAATTGGTGG - Intronic
1196393293 X:115232976-115232998 AAAAATACCCTTAAAATTGTTGG + Intronic
1196505670 X:116437995-116438017 AGAACCACACTTAAAACTGGAGG - Intronic
1197037599 X:121895305-121895327 AGACCTACCCTTAATCTTGGTGG + Intergenic