ID: 916138561

View in Genome Browser
Species Human (GRCh38)
Location 1:161674543-161674565
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916138561_916138569 21 Left 916138561 1:161674543-161674565 CCAACTATATGACCCAAGTGAGT 0: 2
1: 0
2: 0
3: 4
4: 76
Right 916138569 1:161674587-161674609 AGCTGTCTCAAGTGGAAAATGGG 0: 1
1: 1
2: 2
3: 46
4: 436
916138561_916138570 22 Left 916138561 1:161674543-161674565 CCAACTATATGACCCAAGTGAGT 0: 2
1: 0
2: 0
3: 4
4: 76
Right 916138570 1:161674588-161674610 GCTGTCTCAAGTGGAAAATGGGG 0: 1
1: 1
2: 2
3: 47
4: 434
916138561_916138566 13 Left 916138561 1:161674543-161674565 CCAACTATATGACCCAAGTGAGT 0: 2
1: 0
2: 0
3: 4
4: 76
Right 916138566 1:161674579-161674601 TGTGCCTCAGCTGTCTCAAGTGG 0: 1
1: 1
2: 1
3: 25
4: 227
916138561_916138568 20 Left 916138561 1:161674543-161674565 CCAACTATATGACCCAAGTGAGT 0: 2
1: 0
2: 0
3: 4
4: 76
Right 916138568 1:161674586-161674608 CAGCTGTCTCAAGTGGAAAATGG 0: 1
1: 1
2: 4
3: 52
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916138561 Original CRISPR ACTCACTTGGGTCATATAGT TGG (reversed) Intronic
906403786 1:45525179-45525201 ACTCCCTTGGCCCTTATAGTGGG + Intergenic
910720532 1:90281131-90281153 TCTCAGTTGGGTCATATCTTGGG + Intergenic
911574334 1:99557156-99557178 ACTCACTTTGGACATATAAACGG + Intergenic
912562348 1:110559971-110559993 AGTCACTGGGGTCAGACAGTTGG + Intergenic
916128643 1:161592712-161592734 ACTCACTTGGGTCATATAGTTGG - Intronic
916138561 1:161674543-161674565 ACTCACTTGGGTCATATAGTTGG - Intronic
921220998 1:212973974-212973996 TCTCACTTGGGTCGGAGAGTGGG - Exonic
922093821 1:222423900-222423922 GCTAACTTGGGTCATAAAGGTGG - Intergenic
1064978764 10:21145597-21145619 AGCCACTTGGCTCATATTGTAGG - Intronic
1070027207 10:72643144-72643166 ACACACTTGGGTGATAAACTTGG + Intergenic
1070567025 10:77611477-77611499 ACTCCATTGACTCATATAGTTGG - Intronic
1072594656 10:96860165-96860187 ACTGACTTGGGCCATGTGGTGGG + Intronic
1075246623 10:120828121-120828143 ACTCATTTGGATCAGATACTTGG - Intergenic
1084237158 11:67795717-67795739 ACTTACCTGGGCAATATAGTGGG - Intergenic
1085451525 11:76636970-76636992 ACTTGCTTGGCTCATAGAGTGGG + Intergenic
1090220236 11:125014799-125014821 AATTGGTTGGGTCATATAGTAGG - Intronic
1106820915 13:33463625-33463647 ACTCACTAGGGTAACATAGTTGG + Intergenic
1108075854 13:46679183-46679205 AGTCACTTGGGTGATGTTGTTGG - Intronic
1130098366 15:80872962-80872984 GCTATCTTGGGCCATATAGTAGG - Intronic
1130363816 15:83214734-83214756 ACTTACTTGGGTTATATATATGG + Intergenic
1146479773 17:33195830-33195852 ACCCTCCTGGGTCATAGAGTGGG + Intronic
1146913017 17:36660139-36660161 GCACAGTTGGGGCATATAGTAGG - Intergenic
1148625277 17:49064594-49064616 ATTCACATGGGTCATGAAGTGGG - Intergenic
1156649679 18:39210657-39210679 ATTTTCTTGGGTCATATAATTGG + Intergenic
1158203356 18:54963942-54963964 ATTATCTTGGGTCATCTAGTTGG - Intergenic
1161808296 19:6457752-6457774 ACTCACTGGGGTCAGAGAGGTGG + Intronic
1202675279 1_KI270710v1_random:39336-39358 ACTCACTTAGGGGATACAGTCGG + Intergenic
926725308 2:15993104-15993126 ACTGCCTAGGGTCACATAGTGGG - Intergenic
928729462 2:34214662-34214684 GTTAACTTGGGTCATCTAGTGGG + Intergenic
929377337 2:41304094-41304116 ACACAGTTGGATCATAGAGTTGG - Intergenic
929497467 2:42458652-42458674 ATGCACTTAGGTCATATATTTGG - Intronic
929665297 2:43829247-43829269 ACTTATTTGGGTTATACAGTGGG - Intronic
931766412 2:65460555-65460577 ACTCAGTTGGGTTATATAAATGG + Intergenic
932400302 2:71475966-71475988 ACTAACCTGGGCAATATAGTGGG - Intronic
934487692 2:94732244-94732266 TCTCAGTTGGGTCATATCTTGGG - Intergenic
937693369 2:124780973-124780995 ACTCTTTTGGGTGAGATAGTAGG - Intronic
940697585 2:156998801-156998823 ACTCACTTGGGTCCTTCAGGAGG - Intergenic
944472403 2:200068149-200068171 ACTAACCTGGGTAACATAGTGGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
946361550 2:219222044-219222066 ACTCACCTGGTGCATATAGAGGG + Exonic
947437833 2:230088137-230088159 TCTCAGTTGGGTCATATGTTGGG - Intergenic
1171491374 20:25520522-25520544 GCTCACTTTTGGCATATAGTAGG + Intronic
1178768842 21:35483330-35483352 CCACACTTGGGTGATGTAGTGGG - Intronic
955131299 3:56171625-56171647 ACTCACTTAGGTCATCTACATGG - Intronic
956805421 3:72805371-72805393 ATTCACTAGGGTCAAATAGAAGG + Intronic
959418309 3:106104025-106104047 ACTCACTTGGGTGGCATAGGGGG + Intergenic
963618577 3:147574713-147574735 AAACACTTGGGCCATACAGTGGG - Intergenic
963767405 3:149352074-149352096 ACTCACTATGGTCTTATAGTTGG - Intergenic
970176099 4:13340917-13340939 CCCCACATGGGTCATATAGATGG - Intergenic
975522141 4:75312575-75312597 ACTCACTCAGGATATATAGTGGG - Intergenic
977935260 4:102794935-102794957 ACTCAGTTGGGTCCTATACATGG + Intronic
981021574 4:140034957-140034979 ACTTCCTTGGTTCATATTGTTGG - Intronic
985951090 5:3221803-3221825 ACTAACTTGGGACATATTGGTGG + Intergenic
989231311 5:39090089-39090111 ACTCACTTAGGACATACATTGGG + Intergenic
993158735 5:84261162-84261184 ACTCACTTGTGTACTAGAGTTGG - Intronic
994301330 5:98151627-98151649 ACTCAACTGGTTCAAATAGTTGG - Intergenic
1003492334 6:6634360-6634382 TCTCACTTCGGTCAAACAGTAGG - Intronic
1007298342 6:40845996-40846018 CCTCACCTGGTTCATATATTTGG + Intergenic
1021087359 7:16437719-16437741 ACTTTCTTGGGTTATATATTTGG - Intergenic
1022178980 7:27899723-27899745 ACTCACTTGGGTTTTAGAGCAGG + Intronic
1027855736 7:83508848-83508870 AGTCTTTTTGGTCATATAGTAGG - Intronic
1030228298 7:107177241-107177263 AGTCACTTAGGTCATATATTTGG + Intronic
1036848230 8:12184406-12184428 ACCAACTTGGGCCACATAGTGGG - Intronic
1036869592 8:12426687-12426709 ACCAACTTGGGCCACATAGTGGG - Intronic
1040547870 8:48414582-48414604 ATTCACTTAGGTCATCTAATTGG - Intergenic
1041592436 8:59604050-59604072 ACTCACTTATGTCATATATCAGG + Intergenic
1041879580 8:62734083-62734105 ACCTACCTGGGTGATATAGTGGG + Intronic
1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG + Intronic
1051576269 9:18619483-18619505 ACTGACTTGGTTCATATCCTGGG + Intronic
1053670108 9:40352167-40352189 TCTCAGTTGGGTCATATCTTGGG + Intergenic
1054381231 9:64492155-64492177 TCTCAGTTGGGTCATATCTTGGG + Intergenic
1054514505 9:66024130-66024152 TCTCAGTTGGGTCATATCTTGGG - Intergenic
1054865687 9:69998838-69998860 TTTCACTTTGGTCATTTAGTAGG - Intergenic
1056398207 9:86201168-86201190 AATCACTTTGGTCATTTTGTGGG - Intergenic
1057993355 9:99796610-99796632 TCCCACTTGGGTCCTAAAGTTGG + Intergenic
1185825472 X:3245088-3245110 ACTCACTTTGGACAGATAATGGG + Intergenic
1188415562 X:29928875-29928897 ACTATCTCGGGTCATATAGTAGG + Intronic
1195292944 X:103446632-103446654 ATTCAATTGAGTCATATATTGGG - Intergenic
1196484711 X:116192245-116192267 AATCACTTAGGTCATTTACTTGG + Intergenic
1197581470 X:128288873-128288895 ACTCAGTTCGGTCATATTGGTGG + Intergenic
1201987223 Y:19982461-19982483 AATCAGTTGGGTCAAAAAGTTGG + Intergenic
1202036870 Y:20645083-20645105 AATCACTTGGGGCAATTAGTTGG + Intergenic