ID: 916146316

View in Genome Browser
Species Human (GRCh38)
Location 1:161743361-161743383
Sequence CAGTTTGACCTCCGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916146316_916146323 2 Left 916146316 1:161743361-161743383 CCAGCCTCCCGGAGGTCAAACTG No data
Right 916146323 1:161743386-161743408 ACAGCATGGCCCAGGGCCTCAGG No data
916146316_916146322 -5 Left 916146316 1:161743361-161743383 CCAGCCTCCCGGAGGTCAAACTG No data
Right 916146322 1:161743379-161743401 AACTGATACAGCATGGCCCAGGG No data
916146316_916146327 16 Left 916146316 1:161743361-161743383 CCAGCCTCCCGGAGGTCAAACTG No data
Right 916146327 1:161743400-161743422 GGCCTCAGGCATACGGAAACAGG No data
916146316_916146321 -6 Left 916146316 1:161743361-161743383 CCAGCCTCCCGGAGGTCAAACTG No data
Right 916146321 1:161743378-161743400 AAACTGATACAGCATGGCCCAGG No data
916146316_916146324 9 Left 916146316 1:161743361-161743383 CCAGCCTCCCGGAGGTCAAACTG No data
Right 916146324 1:161743393-161743415 GGCCCAGGGCCTCAGGCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916146316 Original CRISPR CAGTTTGACCTCCGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr