ID: 916150425

View in Genome Browser
Species Human (GRCh38)
Location 1:161783241-161783263
Sequence CAAGCCCACCTAAATTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916150421_916150425 30 Left 916150421 1:161783188-161783210 CCAGCTTCAGAATTCACATAGCA 0: 1
1: 0
2: 3
3: 31
4: 209
Right 916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916150425 Original CRISPR CAAGCCCACCTAAATTCTTG GGG Intronic
903496064 1:23768155-23768177 GAAGACCACCTAATTTCTTACGG + Intergenic
907184363 1:52598518-52598540 CACGCACAGCTAAATTCTTTTGG - Intergenic
908431017 1:64057614-64057636 CAGGCCCACCCAAACTATTGAGG + Intronic
909692413 1:78423567-78423589 CAACCCCACCTAAAAGCTTTTGG + Intronic
910907730 1:92199204-92199226 GAAGCCCAGCTATATTCTTGAGG - Intergenic
915398596 1:155605861-155605883 CAATCTCATATAAATTCTTGTGG + Intergenic
915705433 1:157839199-157839221 CAAACCCTTCTAAATTCTGGAGG + Intronic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
921118181 1:212114055-212114077 CAAACCCTCCTAGATTCTTCTGG - Intergenic
921608598 1:217183988-217184010 GAAGCCCACCTAAATTAGAGAGG - Intergenic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
1068818511 10:61345743-61345765 CAAACAAACCTAAATTCTAGGGG - Intergenic
1071468037 10:85958609-85958631 GAAGCCCACCTACATTAGTGGGG - Intronic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1073273075 10:102283330-102283352 CAGGCACAGGTAAATTCTTGAGG + Intronic
1086342879 11:85865318-85865340 CAAACCCACCTCTATTCTTTTGG - Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1092697861 12:11193397-11193419 GAAACCCACCTACATTGTTGAGG - Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1095676805 12:44929293-44929315 CAAGCCCACCTAGGTTCTACTGG - Intergenic
1096880727 12:54667218-54667240 CACCCACACCTAAATTCATGCGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101629458 12:106478879-106478901 CAAGGCCACCAAAATCCTTAGGG - Intronic
1104044526 12:125152474-125152496 CCAGCCCACCTAGATTGGTGGGG - Intergenic
1104597426 12:130129449-130129471 CAAGCCCACTCAAATTCAAGGGG + Intergenic
1105344272 13:19559749-19559771 CAAGGCCCCCTACACTCTTGGGG + Intergenic
1105535762 13:21261825-21261847 CAAGGCCCCCTACACTCTTGGGG - Intergenic
1105589135 13:21775110-21775132 GAAGCCCACCTACATTATTGAGG - Intergenic
1106949114 13:34863035-34863057 CAAGCCTGCCCAAATTCATGAGG - Intergenic
1110158529 13:72347489-72347511 CAATCCCAACATAATTCTTGTGG - Intergenic
1112287672 13:98118441-98118463 CAAGCCCAGCTAATTTTTAGTGG + Intergenic
1115310206 14:31971811-31971833 TAGGCCCACCCAAATTATTGAGG + Intergenic
1116627472 14:47284022-47284044 CAAGGCCACCTAGATTGTTGGGG - Intronic
1116989677 14:51262162-51262184 CATGCCCAGCTAAATTTTGGGGG + Intergenic
1119908771 14:78330424-78330446 CAAGCCCACCTAAATTAGGTGGG - Intronic
1121813933 14:96914700-96914722 CAAGCCCACCCACATTCAAGGGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1127203343 15:56683648-56683670 AAAACCCACCTAAATTTTTAGGG - Intronic
1130857720 15:87855903-87855925 CAAGGCCACCCAGTTTCTTGAGG - Intergenic
1131140477 15:89973078-89973100 CCAGCCTCCCTTAATTCTTGAGG - Intergenic
1131183913 15:90258914-90258936 CTAGCACACCTAGATTCTCGTGG - Exonic
1131943381 15:97592329-97592351 GAAGCCCACCCAGATTATTGTGG - Intergenic
1132063967 15:98715244-98715266 TTAGCCCACCTCATTTCTTGGGG + Intronic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135892595 16:26371044-26371066 AAAGCCCACCTATATTGTTGAGG - Intergenic
1139570423 16:67808229-67808251 CAATCCCACCTAAACTCTTCAGG + Intronic
1140028443 16:71313130-71313152 GAAACACACTTAAATTCTTGAGG + Intergenic
1143560255 17:7689483-7689505 TAAGCCCCCCTGAATCCTTGAGG - Intronic
1144396150 17:14845069-14845091 CAAGAGCACCCAAATTCTAGGGG + Intergenic
1148009184 17:44461845-44461867 CAAGCCCAACTAATTTTTGGGGG + Intronic
1148573259 17:48687931-48687953 CAGGACCACTTATATTCTTGAGG + Intergenic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154117100 18:11620703-11620725 CATGCCCAACTGACTTCTTGAGG - Intergenic
1156761860 18:40601692-40601714 CAAGCTGACCTAAATTTATGTGG + Intergenic
1158933301 18:62341980-62342002 GAAGCCCAACTCAGTTCTTGGGG + Intronic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1163156693 19:15443505-15443527 CAAGCCCACCTAACTCTTTTGGG + Intronic
1163292296 19:16386795-16386817 CAATCCCAGCTCAGTTCTTGTGG - Intronic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1165539434 19:36479787-36479809 CAAGTCCAGCTAAATGTTTGGGG + Intronic
1165878454 19:39026049-39026071 CAAACCCACCTTGATTCATGGGG - Intronic
1167736678 19:51298696-51298718 CAGACCCACCTACATTATTGAGG + Intergenic
1167975137 19:53220365-53220387 CAAGCCCAGCTGAATTCATCTGG + Intergenic
928048004 2:27957757-27957779 CAAGCCCACCCAGATTCAAGAGG - Intronic
929057283 2:37889297-37889319 CAATCTCATCTAAATTCTTCTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935584159 2:104785521-104785543 CCAGCCCACCTCCATTTTTGAGG - Intergenic
937572350 2:123380019-123380041 CAAGCCCACCTAGATGCAAGGGG - Intergenic
939187446 2:138877777-138877799 CAAGCCCACCTGAATGCTGGAGG + Intergenic
940699271 2:157021693-157021715 GATGCCCACCTAAATTGATGAGG + Intergenic
940848133 2:158662648-158662670 CATGCCGACCGAAATGCTTGAGG - Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
946078435 2:217095671-217095693 CAAGTGCACTTAAATTCCTGTGG - Intergenic
946186568 2:217983987-217984009 GAGGCCCACCTAAATTATGGAGG - Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1169100466 20:2943465-2943487 GAAGCCCACCTACATTATGGAGG + Intronic
1169328996 20:4701787-4701809 TAAGCCCACTTAGATGCTTGTGG - Intergenic
1171310366 20:24140411-24140433 CAAGGACAACTGAATTCTTGGGG - Intergenic
1173360707 20:42342045-42342067 CAAACCCACCTACATTATTTGGG + Intronic
1177083741 21:16675817-16675839 AAAGCCAACCTAAACACTTGAGG - Intergenic
1179788452 21:43742334-43742356 CATGCCCAGCTAACTTTTTGTGG + Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181347750 22:22232444-22232466 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1182667329 22:31969380-31969402 CAAGCCCACCTAAATTATCCAGG + Intergenic
1184670455 22:46009707-46009729 CAAGCCCACCTGGATTCAAGAGG - Intergenic
950630480 3:14278713-14278735 CAAGCCCACTTAAACTTCTGGGG - Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
950978374 3:17275243-17275265 CCAGCCCACCCAGATTTTTGAGG - Intronic
951039902 3:17978508-17978530 CAAGCCCACCCAGATTCAAGGGG - Intronic
952380243 3:32798866-32798888 TAAGCCCACCCAAATTTTAGGGG + Intergenic
956497347 3:69842661-69842683 CAAGCAAACCAAAATTCTTGGGG + Intronic
957798587 3:85044492-85044514 CAACCCCAGCTAATTTCTTCTGG - Intronic
960481311 3:118193670-118193692 GAAACCCATCTAAATTCATGAGG - Intergenic
961626287 3:128266130-128266152 GAAGCCCACCTACATTATAGGGG + Intronic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
962448173 3:135487356-135487378 TGAGCCCAGCTAATTTCTTGAGG - Intergenic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
964630895 3:158809034-158809056 CAAGCCCACCTGGATTCAAGGGG + Intronic
965196745 3:165607662-165607684 CCAGACCATCTAAATTCATGGGG - Intergenic
966466826 3:180238511-180238533 CAAGACCACCAAAATGCTTGAGG + Intergenic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969961508 4:10948999-10949021 TAGGCCCACCTAAATTATTGAGG - Intergenic
970150005 4:13079680-13079702 CCAGCCCACCTAATTTCTTAAGG - Intergenic
972935161 4:44125043-44125065 AAAGCTCAAATAAATTCTTGAGG + Intergenic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
976208537 4:82644495-82644517 CAAGCACTCCTAAATATTTGTGG + Intronic
977046787 4:92078333-92078355 CAAGCAAACTTAAATTCTTCTGG + Intergenic
977233405 4:94478865-94478887 CAAGCACACCTACCTTCTTTTGG - Intronic
978284021 4:107053377-107053399 CATGCCCACCTCAACTCTTATGG - Intronic
978322113 4:107508935-107508957 CAAGCAAGCCTAAATACTTGTGG + Intergenic
979154643 4:117368877-117368899 CAAGCCCACCTAAATACAAAAGG + Intergenic
979979027 4:127231884-127231906 CAAGCCCATCCAGATTCATGGGG + Intergenic
980703298 4:136458826-136458848 CCAGCCCACATAAATTCTGGGGG - Intergenic
982634095 4:157870338-157870360 CAAGCCCACCCAAATAATTTGGG + Intergenic
985093675 4:186390494-186390516 TAGGCCCACCTACATTATTGAGG + Intergenic
986124795 5:4875022-4875044 CAAGCCCACCCAGATTCAAGGGG + Intergenic
990314331 5:54569845-54569867 GAAGCCCACCCAGATTCATGGGG + Intergenic
993632508 5:90303097-90303119 CAAACAAACCTAACTTCTTGGGG - Intergenic
996642268 5:125770514-125770536 CAAGCCCACATGGATTCATGTGG - Intergenic
996664167 5:126038516-126038538 GATGCCCATCTAAATTGTTGAGG + Intergenic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000508773 5:162155758-162155780 TAACCACACCGAAATTCTTGAGG - Intergenic
1002015531 5:176318950-176318972 TAAGCCCAGCTAATTTTTTGTGG - Intronic
1007654227 6:43442571-43442593 CAAGCCCAGCTAAATTTTTTTGG - Intronic
1007760482 6:44130594-44130616 CATGCCCAGCTAAATTTTGGTGG + Intronic
1007803393 6:44417472-44417494 CAAGCCCACCTAGATTTATGGGG + Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1008405031 6:51109472-51109494 CAAACCAACCTGAATTGTTGTGG - Intergenic
1008653331 6:53585871-53585893 CTAGCCAACCTAATTTCTTTTGG + Intronic
1009675737 6:66817872-66817894 GAACCCCACCTAAATTCTTTTGG + Intergenic
1012439139 6:99246076-99246098 TAAGCCCAGCTAAAATCTTCAGG - Intergenic
1019646788 7:2134795-2134817 CATGCCCACCTGATTTCTGGTGG - Intronic
1021883057 7:25112407-25112429 CAAGCCCATCTAAATACTGTGGG + Intergenic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1028157431 7:87447435-87447457 CAAGCCAACCAACATTCCTGTGG + Intronic
1029030154 7:97458622-97458644 CATGCCCAGCTAACTTTTTGTGG - Intergenic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1036958929 8:13222722-13222744 CAAATACACCTAAATTTTTGAGG + Intronic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1041624806 8:60013540-60013562 CAAGTCCACCCAGATTCTAGAGG - Intergenic
1042752130 8:72169961-72169983 CATGGCCCCCTAAATTCTTCTGG - Intergenic
1044772394 8:95650326-95650348 CAAGCCTACCTATATTCAAGGGG - Intergenic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1047239978 8:123078115-123078137 CAATCCCACCTAATTGCTTTCGG - Intronic
1048672796 8:136741924-136741946 CAAGCCGAGCCATATTCTTGAGG - Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049569990 8:143365089-143365111 CACGGCCAGTTAAATTCTTGGGG + Intergenic
1051027106 9:12626012-12626034 CAGGCCCACCTACATTATGGAGG - Intergenic
1051363379 9:16302281-16302303 CAAGTCCACCTACATTTGTGGGG - Intergenic
1052498312 9:29257064-29257086 GAAGCCCACAGAAATCCTTGAGG - Intergenic
1052509720 9:29400264-29400286 CAAGCCCACCAATACTCTGGAGG + Intergenic
1052670947 9:31556474-31556496 GAGGCCCACCTACATTATTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1054705134 9:68454076-68454098 CAAGCCCAACTAAAATCTGGAGG - Intronic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1058545901 9:106059949-106059971 CAAGCATCCCTACATTCTTGGGG - Intergenic
1185751324 X:2611765-2611787 CAGGCCCTCCCAAATTCTGGAGG + Intergenic
1187340498 X:18416965-18416987 CAAGCCCACCCAGATTCAAGGGG + Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188072680 X:25736559-25736581 GAAACACACTTAAATTCTTGAGG - Intergenic
1189224320 X:39399809-39399831 CAAGCCCACCCAGATTCTAGAGG + Intergenic
1189349429 X:40265888-40265910 CACGCCCAGCTAAATTTTTTTGG - Intergenic
1195947243 X:110228315-110228337 CAAGGCCCCCTAAAGTCATGGGG + Intronic
1196493204 X:116292373-116292395 CAAGCCAACCTAAGTTTATGGGG + Intergenic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1199838210 X:151615101-151615123 GAAAACCACCCAAATTCTTGTGG + Intronic
1200865626 Y:8040434-8040456 CACGCTCACCAAAATTATTGTGG + Intergenic
1201580187 Y:15502968-15502990 CAAGTCCACTTATATTTTTGTGG + Intergenic