ID: 916155743

View in Genome Browser
Species Human (GRCh38)
Location 1:161845240-161845262
Sequence CTGTGGTTCTAAAGGAAAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916155743 Original CRISPR CTGTGGTTCTAAAGGAAAAG CGG (reversed) Intronic
900835537 1:5000573-5000595 CTGTGACTCTCAAGGAAGAGAGG - Intergenic
902148393 1:14422363-14422385 CTGTGCTATTGAAGGAAAAGGGG - Intergenic
902842144 1:19081566-19081588 CTCGGGTTCTAGAAGAAAAGCGG + Exonic
903289220 1:22297321-22297343 CTTGGGTTCCCAAGGAAAAGAGG - Intergenic
903571377 1:24308123-24308145 CTGAGGTTCTGAAGTAACAGGGG + Intergenic
905527471 1:38649895-38649917 CTTTGGTGCTAAAGGATAGGGGG - Intergenic
907041004 1:51259309-51259331 CTGAGGTTAGAGAGGAAAAGGGG - Intronic
907620049 1:55968352-55968374 CTAGGGTTGTAGAGGAAAAGGGG - Intergenic
907627464 1:56044077-56044099 CTGTGGCTCTAAATAAAATGGGG - Intergenic
907669341 1:56461220-56461242 TTATGGTCTTAAAGGAAAAGGGG - Intergenic
907983594 1:59508730-59508752 CTGTGGTTCCAAATGAAAGATGG + Intronic
909502756 1:76353861-76353883 CTGGGGTTCTGAAGGTAAAGGGG - Intronic
914402352 1:147334385-147334407 TCGTGGTTCTATAGGAAAATGGG + Intergenic
914920051 1:151840202-151840224 CTGTGTTTATCCAGGAAAAGAGG - Exonic
915768460 1:158391984-158392006 CTGTGGTTCTAATGGAGAGATGG + Intergenic
915825085 1:159067368-159067390 CTTTGGTTCTAAATGGCAAGTGG - Intronic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916653995 1:166856944-166856966 CTTTGGTTTTAAATGCAAAGAGG + Exonic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
918223339 1:182456017-182456039 ATGAGGGTCTAAAGGGAAAGGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921634151 1:217472827-217472849 CTGTAGTGCTCAAGGATAAGTGG + Intronic
921884171 1:220287800-220287822 ATTTGATTCTAAAGGAACAGTGG - Intergenic
922160280 1:223074610-223074632 CTGGGGATCCAGAGGAAAAGGGG + Intergenic
922640010 1:227220682-227220704 GTAGGGTTCAAAAGGAAAAGAGG - Intronic
923016180 1:230128273-230128295 GTGTGGTTATGAAGGAAAACAGG + Intronic
924319232 1:242830615-242830637 CTGTGATTCCAAAAGAAGAGAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1066441015 10:35438635-35438657 CTGTGGTTCTAAATGTATACAGG - Intronic
1069136724 10:64776464-64776486 CTTAGGTTCAAAAGGAAAAAAGG + Intergenic
1069196224 10:65554892-65554914 CTGGGGTAGTAAAAGAAAAGAGG - Intergenic
1069892842 10:71662666-71662688 ATGTGGTAGAAAAGGAAAAGGGG - Intronic
1070763120 10:79037737-79037759 CTGTGCTTCTATATGAAAATAGG - Intergenic
1071661842 10:87512026-87512048 CTGTTTTCCTAAAGGAAAATGGG - Intronic
1072221959 10:93334275-93334297 CAGAGGTGCTACAGGAAAAGCGG - Intronic
1072429048 10:95355401-95355423 CTGTGTTTCGAAAGAAAAATTGG - Intronic
1072997956 10:100263202-100263224 CTGTGGTTCTATAGGCAGTGGGG - Intronic
1073008873 10:100345169-100345191 CTGTGGTTCTCAAGTGACAGTGG - Intergenic
1073502208 10:103950695-103950717 ATGTGGTACTAGAGGAATAGAGG + Intergenic
1073866325 10:107808622-107808644 CCGTGGTTCTAAATCATAAGAGG + Intergenic
1075162225 10:120034375-120034397 CTGAGCTACAAAAGGAAAAGAGG + Intergenic
1076044074 10:127276539-127276561 TTGTGGTCTTAAAGGAACAGAGG - Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1076608410 10:131704219-131704241 CTGGGGATCTAAAAGAGAAGAGG - Intergenic
1077493392 11:2872645-2872667 CTGTGGTTTTAAGGCAAAACTGG - Intergenic
1078470443 11:11581841-11581863 CTGTGGGTCTCAAAGAAAAGAGG - Intronic
1078741050 11:14066707-14066729 ATGTGGCTGTAAAGGAAAGGTGG - Intronic
1081200338 11:40207315-40207337 TTATGGTTTTAAAGGATAAGAGG + Intronic
1082665017 11:55964784-55964806 TTGTGGTTTTAGAGGAAATGGGG - Intergenic
1084394198 11:68898177-68898199 CTGTGGTTCTAAAAGGATACAGG - Intronic
1088157171 11:106821090-106821112 CTGTGATTTAAAAAGAAAAGTGG - Intronic
1088819182 11:113442581-113442603 CTGTGTTTCTGAAGAAACAGGGG - Intronic
1089077982 11:115753947-115753969 CTGTGGGTCAATAGGGAAAGAGG + Intergenic
1089498698 11:118920624-118920646 TCGGTGTTCTAAAGGAAAAGGGG - Intronic
1089569065 11:119390477-119390499 CTGTGGTCCTGAACGTAAAGTGG - Intergenic
1090006087 11:123003417-123003439 CTTTGGTTCAACAGGTAAAGTGG - Intergenic
1090484946 11:127104912-127104934 CTGTAGTGCTAATGGAAAAGGGG + Intergenic
1090643800 11:128751100-128751122 CCATGGTTTTAAAGGAAGAGTGG + Intronic
1090655736 11:128843448-128843470 CTGAGGCACTAAAGAAAAAGTGG - Intronic
1092217988 12:6695652-6695674 CTGGGGTACCAGAGGAAAAGAGG + Intronic
1092671428 12:10866376-10866398 GTGTAATTCTGAAGGAAAAGAGG + Intronic
1095169345 12:39015493-39015515 TTGTTGTACTAAAAGAAAAGAGG + Intergenic
1095296349 12:40531561-40531583 CTGTGGGTGGAAAGGAAAACTGG - Intronic
1095662639 12:44755548-44755570 CTGTGGCTATACAGGTAAAGTGG - Intronic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097957955 12:65505872-65505894 TTGTGGTTCCAAGGGGAAAGGGG - Intergenic
1098414609 12:70218816-70218838 CTATCATTATAAAGGAAAAGAGG + Intergenic
1098430826 12:70418143-70418165 ATTTGGTTCTCAAGGAAATGAGG - Intronic
1098430886 12:70418780-70418802 ATTTGGTTCTCAAGGAAATGAGG - Intronic
1100766541 12:97872401-97872423 CTGTGGTTTTAAAGTAAGAAGGG + Intergenic
1101119978 12:101569075-101569097 CTGTATTTCTAAAGTAAAAATGG - Intronic
1102679383 12:114680681-114680703 CTGGCGTTCTAAAAGAAATGGGG - Intronic
1103367343 12:120392958-120392980 CTGTGCTTTTTAAAGAAAAGGGG - Intergenic
1105501926 13:20980397-20980419 ATGAGGCTCTGAAGGAAAAGTGG - Intronic
1106117725 13:26831404-26831426 CTGTGGATCTAAAGGATGAGGGG + Intergenic
1106202130 13:27547845-27547867 CTGTGGTTCAAAAAAAAATGGGG + Exonic
1108239296 13:48445549-48445571 CTGTGCTTTGAAAGGAGAAGGGG - Intronic
1108433590 13:50379572-50379594 CTGGGGTAATAAAGGACAAGAGG - Intronic
1109069667 13:57748357-57748379 CTGGGGTACTAAAGGGAAATTGG + Intergenic
1109469553 13:62787837-62787859 CTGAGGTTCTACGGGAAAACAGG - Intergenic
1110399320 13:75071306-75071328 CAGTTATTCTAATGGAAAAGAGG - Intergenic
1111705444 13:91743169-91743191 CTGACTTTCCAAAGGAAAAGGGG - Intronic
1112157213 13:96831174-96831196 CTGTGGTTTAAAAGGACAAGGGG - Intronic
1113373097 13:109740429-109740451 CTGCTGTTATAAAGGAAAAGAGG + Intergenic
1113896770 13:113769518-113769540 CACTGGTTCAAAAGGAAGAGAGG - Intronic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1114758654 14:25286877-25286899 GAGTGGTTCTACAGGAACAGAGG - Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1117252488 14:53951239-53951261 AAGTGGTTGTAAAGAAAAAGAGG + Intronic
1119294368 14:73521091-73521113 CTGTGGATTTAATGGAAAGGGGG - Intronic
1119978553 14:79053704-79053726 CTGTGATGGTAAGGGAAAAGAGG + Intronic
1120012225 14:79429278-79429300 CTATGGTTGAATAGGAAAAGTGG - Intronic
1120678371 14:87449811-87449833 CTGTGGGTTTAAAGGAATAGTGG - Intergenic
1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG + Intronic
1121176183 14:91892364-91892386 CCCTGGTTCCAAAGGAACAGGGG - Intronic
1122347171 14:101067689-101067711 CTGTGGCTCCAAAAGAAGAGGGG - Intergenic
1123149703 14:106169202-106169224 CTGTGGTACTTAGGGAAACGAGG + Intergenic
1123163937 14:106307835-106307857 CTGTGGTACTTAAGGAAGGGAGG + Intergenic
1127112371 15:55688407-55688429 CTGTGGTTGAAAACTAAAAGAGG - Intronic
1129445764 15:75616758-75616780 CTGTGGTACCATAGGGAAAGAGG - Intronic
1130243726 15:82222982-82223004 CTGTGGTTGTAAATGAAGTGTGG - Intronic
1130456750 15:84118293-84118315 CTGTGGTTGTAAATGAAGTGTGG + Intergenic
1131472139 15:92706702-92706724 CTGTGGTTTGCAAGGACAAGTGG + Intronic
1132239096 15:100244002-100244024 GTCTGGGTATAAAGGAAAAGAGG + Intronic
1133493057 16:6290319-6290341 CTGTGGTTTTAAGGAAAATGAGG + Intronic
1135197277 16:20404743-20404765 CTGGGGTTCTAGAGGACCAGGGG + Intergenic
1135490164 16:22902254-22902276 CTGTGGTTCTGATAGAAATGTGG + Intronic
1136680356 16:31957593-31957615 CTGTGGTACTTAGGGAAATGAGG - Intergenic
1136780700 16:32899138-32899160 CTGTGGTACTTAGGGAAATGAGG - Intergenic
1136872247 16:33817945-33817967 CTGTGGTACTTAGGGAAAGGAGG - Intergenic
1136889712 16:33960532-33960554 CTGTGGTACTTAGGGAAATGAGG + Intergenic
1137881295 16:52051171-52051193 CTCTGGTTTTGAAGGAAAACTGG - Intronic
1138262233 16:55632167-55632189 CAGAGGTTATAAAGGTAAAGGGG + Intergenic
1139359761 16:66390249-66390271 CTGGGATTCTCAAGGTAAAGAGG - Intronic
1140716818 16:77734085-77734107 GTGTGTTGGTAAAGGAAAAGAGG - Intronic
1141753832 16:85978101-85978123 CTGTGGCACTAAAGAGAAAGCGG - Intergenic
1203083354 16_KI270728v1_random:1163166-1163188 CTGTGGTACTTAGGGAAATGAGG - Intergenic
1203099925 16_KI270728v1_random:1298123-1298145 CTGTGGTACTTAGGGAAAGGAGG + Intergenic
1144075407 17:11715116-11715138 CTGTGCTTATCACGGAAAAGTGG - Intronic
1144511810 17:15883480-15883502 CTGTGGTTCTGGAGGAGAGGAGG + Intergenic
1146063732 17:29620212-29620234 TTGTGGTTCCAAGGTAAAAGTGG - Intronic
1148538410 17:48459958-48459980 CTCTGGTGGAAAAGGAAAAGGGG + Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148665804 17:49373802-49373824 CTATGATTCTAAAGGAATAGGGG - Intronic
1149887433 17:60354365-60354387 GTTTGGTTCCAAAGGCAAAGAGG + Intronic
1150412385 17:64956164-64956186 TTGTGTTTCTAAAGAAAAATGGG - Intergenic
1150799510 17:68269459-68269481 TTGTGTTTCTAAAGAAAAATGGG + Intronic
1151100433 17:71550199-71550221 TGGGGGTTCCAAAGGAAAAGAGG + Intergenic
1151781946 17:76252559-76252581 CTGTGTTTCTGAAGGAGAAGGGG + Intergenic
1153350424 18:4075070-4075092 CAGTGGTTCTAAAGTAGAAAAGG - Intronic
1154063245 18:11083286-11083308 TTGTGGTTCTTTATGAAAAGAGG + Intronic
1155892004 18:31281757-31281779 CTGTGGTTCCAAAAGATAAGTGG + Intergenic
1156775722 18:40786145-40786167 ATGTGGACCTAAAGCAAAAGAGG + Intergenic
1157161187 18:45315820-45315842 ATGTGGAGCTAAAGGAGAAGAGG + Intronic
1158016605 18:52791274-52791296 CTGAGATTTTAAAGAAAAAGTGG - Intronic
1159729309 18:72005216-72005238 CTTTGGCTCTAAAGGATAATGGG - Intergenic
1161050531 19:2161639-2161661 CTGGGGTTTTATAGAAAAAGAGG + Intronic
1162248544 19:9423534-9423556 CAGTGGATCTACATGAAAAGTGG + Intronic
1162302164 19:9850161-9850183 CTGTGGGTCTGATGGAGAAGTGG + Intergenic
1164109736 19:22144841-22144863 CTGAAATTCTAAAGAAAAAGTGG + Intergenic
1167792447 19:51690363-51690385 CTTGGGTTCTAGAGGAACAGAGG - Intergenic
925133397 2:1510097-1510119 CTCTGGTTTGAAAGGAAGAGAGG - Intronic
925273580 2:2633124-2633146 CTGTGGGGCTGTAGGAAAAGCGG + Intergenic
925649599 2:6075216-6075238 ATGTGCTTCTAAAAGAAAAGAGG + Intergenic
926042724 2:9687422-9687444 CTGTGGTACAAAAGGAAATGAGG + Intergenic
926156544 2:10457798-10457820 CTGTGATTGTGAAGGCAAAGAGG - Intergenic
929288510 2:40163448-40163470 CTCTGATTCCAAATGAAAAGAGG + Intronic
930644211 2:53886975-53886997 CAGTGGTTATAAAGGATGAGGGG + Intronic
931036491 2:58250000-58250022 CTGGGCTTCTAAATGAAAACCGG + Intergenic
931669874 2:64637513-64637535 CCTTGATTCTAAATGAAAAGTGG - Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
932805925 2:74783445-74783467 CTGTGATTCCAAAGCAAAAGTGG + Intergenic
934784463 2:96995045-96995067 GTGTGGTTCTACAGGAAAGAGGG + Intronic
934863677 2:97786925-97786947 ATATAGTTCTGAAGGAAAAGGGG - Intronic
935628731 2:105194239-105194261 CGGTGGTTCCCAAGGAAACGAGG - Intergenic
936343939 2:111661037-111661059 CTGGGTTTCAAAAGGAAAAATGG - Intergenic
937670386 2:124531941-124531963 CTGGGTTTCTAAAGGCAAATGGG + Intronic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
938936284 2:136130477-136130499 CAGTCGTTCTTAAGGAAAATAGG + Intergenic
939991340 2:148878623-148878645 ATGTGGCACTAAAGGAAATGAGG + Intronic
940609778 2:155975398-155975420 CTGTTGTTTTAGAAGAAAAGAGG + Intergenic
941477422 2:165966958-165966980 CTGTAGTTTTAAAGAAAGAGAGG + Intergenic
942464478 2:176193038-176193060 CTGTGTTTATACAGGAAAAGAGG + Intergenic
943063986 2:183068500-183068522 CTATGGTTTTAAAGCATAAGTGG + Intergenic
943649057 2:190437223-190437245 CGATGATTCTAAAGGGAAAGAGG + Exonic
944370575 2:198978141-198978163 CTGTGGTACTAATATAAAAGTGG + Intergenic
944505648 2:200408049-200408071 CTGGAGCTATAAAGGAAAAGGGG + Intronic
945606058 2:211933137-211933159 CTATGGTGCTCAGGGAAAAGAGG - Intronic
947168866 2:227290742-227290764 TTCAGGTTCTAAAGGAAAAAGGG + Exonic
947932773 2:233977366-233977388 ATGTGTTTTTAAAGGAAAAGAGG - Intronic
948819944 2:240537415-240537437 GTGAGGTTTTAAAGGAAAAGGGG - Intronic
1169556186 20:6752764-6752786 CTTTGTTTCTAAAGGTAAACAGG - Intergenic
1169596817 20:7209885-7209907 CTGAGGTTAGAGAGGAAAAGAGG + Intergenic
1170183429 20:13559610-13559632 CTTTGGTTCTAGATGTAAAGAGG + Intronic
1170747699 20:19115415-19115437 CTGAGATTCAAAAGAAAAAGAGG - Intergenic
1170964426 20:21053327-21053349 CTGGTGTTTAAAAGGAAAAGGGG - Intergenic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1175128182 20:56768033-56768055 CTGAGGTTAGATAGGAAAAGTGG - Intergenic
1176082676 20:63281866-63281888 CTGTGGTGTTACAGGAGAAGGGG + Intronic
1176098470 20:63354491-63354513 CTGTGGTCCTAGAGGAACTGTGG + Intronic
1180015094 21:45076492-45076514 CTGTAGTTGGAAAGGAAAAAAGG + Intronic
1183125161 22:35771261-35771283 CTGTGCTTATAAGTGAAAAGCGG + Intronic
1185130911 22:49038091-49038113 CTGTCTTTCTACAGGAAAACGGG + Intergenic
949306542 3:2648111-2648133 TGGTGGTTCTGAAGGCAAAGTGG - Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
952006995 3:28853121-28853143 TTGTAGTTATAAAGCAAAAGAGG + Intergenic
953807066 3:46079649-46079671 CTGTGGTTTTACCTGAAAAGGGG - Intergenic
956074237 3:65488054-65488076 CAGTGGTTCTAAGGGAAACAGGG + Intronic
957335787 3:78827421-78827443 CTGAGCTTCTAAAGTTAAAGAGG + Intronic
957540834 3:81566827-81566849 CTGTAGTTCCAAAGCACAAGTGG - Intronic
959222227 3:103535018-103535040 ATGTGGTTATAAAGGAGAGGAGG + Intergenic
960468890 3:118035232-118035254 CTATGGTTGTGAAGTAAAAGAGG - Intergenic
960676779 3:120203118-120203140 CTGAGGTTCTAGGCGAAAAGAGG - Intronic
960812994 3:121642948-121642970 CTTTGATTATAAAGGAGAAGTGG - Exonic
961093573 3:124136417-124136439 CTCTCGTTCTAAAGGATCAGGGG - Intronic
963606513 3:147416471-147416493 CTGTGGTATTAAAGCAAAAGGGG - Exonic
965023853 3:163272173-163272195 ATGTGGGACAAAAGGAAAAGTGG - Intergenic
965714124 3:171584571-171584593 CACTGGTTGAAAAGGAAAAGTGG - Intergenic
966401072 3:179547225-179547247 CTGTGGTTCTTAAAGAGTAGAGG - Intergenic
969256631 4:6006925-6006947 CTTTGGTGCTACAGGTAAAGTGG + Intergenic
970298562 4:14658040-14658062 GAGTGGTTTTAAAGGAAAAGAGG + Intergenic
971140699 4:23921815-23921837 CTGTGGTTTAAAAGGAAACATGG + Intergenic
972164415 4:36265248-36265270 CTGTGGTCCTAAAGCAACTGAGG - Intergenic
973225381 4:47777949-47777971 CTCTGGTTCTGAAAGAAAATTGG - Intronic
973302909 4:48609316-48609338 CTGTGGATTTAAAAGAAATGGGG + Intronic
974311721 4:60219865-60219887 CTATAATTATAAAGGAAAAGTGG + Intergenic
977180652 4:93869504-93869526 CTCTGATTCTAAAGCAAAATGGG - Intergenic
977565748 4:98578790-98578812 CTTTGGATCTGGAGGAAAAGTGG - Intronic
980834323 4:138172727-138172749 CAATGGTTCTGAAGGAAAAAAGG - Intronic
982103633 4:151992652-151992674 CTCTGCTCCTGAAGGAAAAGTGG + Intergenic
982288846 4:153760113-153760135 CTGAGGTTCTGAAGGAACCGGGG - Exonic
987664650 5:20921693-20921715 CTGTGGTTCTGAACCTAAAGGGG + Intergenic
988128957 5:27078892-27078914 CTGAGGTACAAAAGAAAAAGAGG + Intronic
988758034 5:34280489-34280511 CTGTGGTTCTGAACCTAAAGGGG - Intergenic
989273199 5:39556172-39556194 TTGTAGTTTTAAAGAAAAAGGGG - Intergenic
991920557 5:71652654-71652676 CTGGAGAACTAAAGGAAAAGAGG - Exonic
992686995 5:79208831-79208853 CTGTGCTTCTTCTGGAAAAGAGG + Intronic
993228934 5:85206014-85206036 CTGTGAGTCTAAAAGAAAAGAGG - Intergenic
993880609 5:93356273-93356295 CTGTGGTTCAGAAATAAAAGAGG - Intergenic
996354701 5:122582702-122582724 CTGTGGTAGGAAAGGAAAATGGG - Intergenic
997605943 5:135176104-135176126 CTAAGTTTCTAAAGGAACAGGGG + Intronic
998005330 5:138653173-138653195 CTTTGTTTCTAAAGGGAATGTGG - Intronic
998620841 5:143792687-143792709 CTGAGGTTCCAAAGAAAAGGGGG - Intergenic
998861551 5:146448412-146448434 CAGTGGTTTTTGAGGAAAAGAGG + Intronic
999117906 5:149180570-149180592 CTGTGATTATAAAAGAACAGTGG - Intronic
999692845 5:154163715-154163737 ATCTGGTTCTAAAGGCAAATAGG + Intronic
1002483334 5:179517532-179517554 CTGTGGTAATAAAGAAAAACAGG + Intergenic
1003078792 6:3004472-3004494 CTGTGGATGGAAAGGAAAAGAGG - Intronic
1004024494 6:11805672-11805694 CTAGGCTTCTAAAGGAAAATAGG + Intronic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004126666 6:12880869-12880891 CTGTGGCTCAAAAGGAAATTTGG + Intronic
1006315184 6:33287285-33287307 CTGGGGTCCTAAAGGAGAGGTGG + Intronic
1006796647 6:36736312-36736334 TTGAGGTTCAAATGGAAAAGTGG - Intergenic
1008333223 6:50267911-50267933 CTGTAGCTCTAAAGAAACAGTGG + Intergenic
1009492272 6:64306182-64306204 CAGGGCTTCTAAAGGAAAAGAGG + Intronic
1010352935 6:74897488-74897510 TTGTGTTTCTATAGGAGAAGTGG + Intergenic
1011814341 6:91171063-91171085 CTGTGTTCCTACAGGAAAATGGG - Intergenic
1014477483 6:121891176-121891198 CTGAGGATATAAATGAAAAGAGG - Intergenic
1017872640 6:158500163-158500185 CTGTGGTTCTCAATGAGAGGAGG + Intronic
1020529025 7:9306175-9306197 ATGTGCTTCTAAATCAAAAGTGG + Intergenic
1020700154 7:11471561-11471583 CTGGGGTTTTAAAGTAAGAGAGG - Intronic
1021101354 7:16588113-16588135 AAGTGGTTGGAAAGGAAAAGGGG + Intergenic
1021960043 7:25861787-25861809 ATGTGGTTCTAAAACAAAATGGG + Intergenic
1023893267 7:44409868-44409890 CTGGAGTTCAAAAGTAAAAGGGG + Intronic
1025012870 7:55412563-55412585 CTGGGGTACTATAGGAAAATTGG + Intronic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030187573 7:106778642-106778664 CTGTGGGTCCCAAAGAAAAGAGG - Intergenic
1030328685 7:108249797-108249819 GTGTGGTTTTATAGAAAAAGGGG - Intronic
1030747628 7:113186977-113186999 ATGCTGTTCTAAAGTAAAAGTGG + Intergenic
1031556056 7:123177875-123177897 CTGTCTTTCTAGAGGAAAGGAGG - Intronic
1032333972 7:131007405-131007427 CTCTGAGTCTAAAGGAAAACGGG + Intergenic
1033007865 7:137587014-137587036 CTGATGTTCTAATGGAAGAGGGG - Intronic
1033016673 7:137678501-137678523 CTGTGGATCTGAATGAATAGAGG - Intronic
1033253924 7:139783125-139783147 CTGTGGCTTTAAGGGCAAAGGGG + Intronic
1033665106 7:143433315-143433337 CTGTGTTTGAAAAGGAAATGAGG + Intergenic
1033680560 7:143590780-143590802 CTGTGGTTTTGAAGTAAAATTGG - Intergenic
1033704334 7:143871032-143871054 CTGTGGTTTTGAAGTAAAATTGG + Intronic
1034324078 7:150213643-150213665 CTATGGATCTAAACCAAAAGGGG + Intergenic
1034769117 7:153755593-153755615 CTATGGATCTAAACCAAAAGGGG - Intergenic
1036743638 8:11389053-11389075 CTATGGTTCTAGAGGCACAGGGG - Intergenic
1037052580 8:14394683-14394705 CTGTGGTAGTAAAGATAAAGTGG + Intronic
1038217675 8:25577652-25577674 CTGTTGTCTAAAAGGAAAAGAGG - Intergenic
1038900319 8:31834936-31834958 TTGTGATTCTATAGGAAAAGGGG - Intronic
1041698675 8:60763894-60763916 CTGTGGTCAGAGAGGAAAAGAGG + Intronic
1043453214 8:80389519-80389541 TTGTGGTACTAAATGAATAGGGG - Intergenic
1045372026 8:101533948-101533970 CTTCTATTCTAAAGGAAAAGGGG + Intronic
1045574180 8:103401033-103401055 CTTTAATTCTAAAGGAACAGAGG - Intronic
1046724676 8:117661589-117661611 ATGTGTTGCTAAAGGCAAAGAGG - Intergenic
1047080642 8:121455973-121455995 CTGTTGTTCTAAAAATAAAGAGG + Intergenic
1048889186 8:138932778-138932800 TTCTGGTTCCAAAGGAAAGGTGG + Intergenic
1050864793 9:10484880-10484902 ATGGGTATCTAAAGGAAAAGTGG - Intronic
1050934563 9:11379309-11379331 TTGTGGATCTAAAAGAAAACTGG + Intergenic
1053257903 9:36634697-36634719 CTCTGTTTCAAAAAGAAAAGAGG + Intronic
1055310895 9:74978480-74978502 CTGTGTTCCTACAGGAAAAAAGG + Intergenic
1055358286 9:75460710-75460732 CTGTGATCCTAAAGGTAAAGTGG - Intergenic
1055927667 9:81527312-81527334 CTGAATATCTAAAGGAAAAGTGG + Intergenic
1057691513 9:97290831-97290853 CTGAGGTTTAAAAGGAAAAAAGG - Intergenic
1058160881 9:101569430-101569452 ATGTGGTTGTACAAGAAAAGTGG + Exonic
1059135075 9:111797517-111797539 TTGTGATTAGAAAGGAAAAGCGG - Intergenic
1059241823 9:112812843-112812865 CTGTTGTTTTAAGGGAAAATGGG - Intronic
1060048444 9:120359331-120359353 CTCAGGCTCTACAGGAAAAGAGG + Intergenic
1061715544 9:132516483-132516505 GTGTGGTTCCAAAGGACAAGAGG + Intronic
1185914555 X:4021757-4021779 GTGTCCTTCTAAAAGAAAAGAGG + Intergenic
1186155500 X:6721537-6721559 TTGTGGTTCTAAAAGAACAGAGG + Intergenic
1187371201 X:18707846-18707868 CTGTGGTTATGAATGAAAAGGGG + Intronic
1187516319 X:19974457-19974479 CACTAGTTTTAAAGGAAAAGTGG + Intergenic
1188806183 X:34593034-34593056 CTGTGTTACTAAGGTAAAAGAGG + Intergenic
1189845273 X:45130661-45130683 CTGTGTTTATAAAGGGACAGAGG - Intergenic
1193369379 X:80676219-80676241 CTGTGATACAAAAGCAAAAGAGG + Exonic
1195759740 X:108233610-108233632 CTCTGGTTCTAAATGAATACAGG - Intronic
1196687938 X:118528384-118528406 ATGTGGTTCAAAATGACAAGGGG + Intronic
1197198897 X:123732305-123732327 CGGTGGTTCTTCAGGGAAAGCGG + Intronic
1199344691 X:146724541-146724563 ATGTTGTTCTCAAGGCAAAGAGG - Intergenic
1199755774 X:150863757-150863779 CTGAGGTTATAATGGATAAGTGG + Intronic
1200416216 Y:2913479-2913501 CTGTGTCTCTATAGGTAAAGTGG - Intronic
1200635076 Y:5641967-5641989 CTGTGGAGCTTAAGAAAAAGTGG + Intronic
1201054585 Y:9976005-9976027 CTGTGATTCAGAAGGAAAAAAGG + Intergenic