ID: 916155912

View in Genome Browser
Species Human (GRCh38)
Location 1:161847612-161847634
Sequence TCACCTTGATGATCTCTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916155910_916155912 21 Left 916155910 1:161847568-161847590 CCTGCTTTTTTACATGCCAAAAT 0: 1
1: 0
2: 0
3: 25
4: 262
Right 916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG 0: 1
1: 0
2: 2
3: 12
4: 162
916155911_916155912 5 Left 916155911 1:161847584-161847606 CCAAAATTCATCATACTTCTTAA 0: 1
1: 0
2: 1
3: 37
4: 432
Right 916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG 0: 1
1: 0
2: 2
3: 12
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916155912 Original CRISPR TCACCTTGATGATCTCTTAA CGG Intronic
900304493 1:1997974-1997996 CCACATTGATAATTTCTTAATGG - Intronic
900918698 1:5657173-5657195 TCACTTTTATGATCCCTGAAAGG + Intergenic
906091931 1:43186841-43186863 TCACCTTGCTGATCTCTGTCAGG - Exonic
908855913 1:68428088-68428110 ACACATTGGTGATCTCTAAAGGG + Intergenic
912152236 1:106873973-106873995 TTACATTATTGATCTCTTAAAGG - Intergenic
913700205 1:121367190-121367212 ACACCTTCATAATCTGTTAAAGG + Intronic
916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG + Intronic
920487619 1:206385911-206385933 ACACCTTCATAATCTGTTAAAGG + Intronic
923099633 1:230802116-230802138 TCACCTTGATCCACTCTTATCGG - Intergenic
924426086 1:243951591-243951613 TGGCCTTGATGACTTCTTAATGG + Intergenic
1064540058 10:16396215-16396237 CCACCTTGATCATCTCTCAAAGG - Intergenic
1065217676 10:23465483-23465505 TCAGCTAGATTATCTCTCAAAGG - Intergenic
1066230486 10:33427924-33427946 TCATCTTGATCATCACTTGATGG + Intergenic
1066474803 10:35736349-35736371 TCAACTCAATGAACTCTTAAAGG - Intergenic
1066583095 10:36901814-36901836 TTACCTTAATTACCTCTTAAAGG + Intergenic
1069517820 10:69093294-69093316 TTACATTGATGATATGTTAAAGG + Intronic
1070695920 10:78562919-78562941 TCACCTCCAAGATCTCTAAAGGG - Intergenic
1071432021 10:85613647-85613669 TCACCTTGATTGTGTCTTACAGG - Exonic
1073276109 10:102312936-102312958 TCATCTTGATGGTCTCCAAATGG + Intronic
1073382252 10:103088059-103088081 TCAGTTTGATATTCTCTTAAAGG - Exonic
1074917405 10:117970958-117970980 TAACCTTGATGATCACTTGAAGG - Intergenic
1078604548 11:12763606-12763628 GCATCTTGATGATCTCATATTGG + Intronic
1079543609 11:21606412-21606434 TCATCCTGAAAATCTCTTAAGGG - Intergenic
1082279068 11:50250884-50250906 CCAGATTGCTGATCTCTTAAAGG - Intergenic
1083030996 11:59592024-59592046 GCCCCTTGAGGATCTCTAAAGGG - Intronic
1085192373 11:74638924-74638946 TCACTTTGATGTTCACTTAGAGG - Intronic
1085759114 11:79226616-79226638 ATACCTTGATGATCTGTAAAAGG + Intronic
1085983887 11:81760727-81760749 TGGCCTTATTGATCTCTTAAAGG - Intergenic
1086814297 11:91349378-91349400 TTACCATAATTATCTCTTAAAGG - Intergenic
1089701028 11:120243834-120243856 GCACCTTGTTGATCCCATAATGG + Intronic
1091497324 12:983838-983860 TAACCTTCATTATCTCTTCAGGG + Intronic
1094057974 12:26285835-26285857 TAACCTTAATTACCTCTTAAAGG - Intronic
1094132901 12:27094151-27094173 CCACCTTGCAGATCTCTTCATGG + Intergenic
1097648373 12:62262901-62262923 TCACGTTAATTTTCTCTTAAAGG + Intronic
1098999490 12:77161679-77161701 GCTCCTTTATCATCTCTTAATGG - Intergenic
1099175364 12:79415210-79415232 TAACATTGGTTATCTCTTAATGG - Intronic
1099514647 12:83582928-83582950 TCCCCTTGATTATCTCTCATTGG - Intergenic
1099638584 12:85251707-85251729 TCACCATAATGTTCTCTTAATGG - Intronic
1100077135 12:90799084-90799106 TCACCCTGATGCTATCTAAATGG - Intergenic
1101010180 12:100441387-100441409 TCAGCTTGTTGCTCTCTAAATGG + Intergenic
1102585024 12:113916692-113916714 TCACCTTGGGGATCTCTTTCTGG - Intronic
1103262841 12:119603484-119603506 TCACCTTGATGATTATTTGAAGG - Intronic
1104232059 12:126895110-126895132 TCACACTAATGATCTTTTAAAGG + Intergenic
1110203940 13:72888862-72888884 TCACAGTGATTATCTCTCAAAGG + Intronic
1111198639 13:84905685-84905707 CCACCTCTATGATCTCTCAATGG + Intergenic
1112830512 13:103444241-103444263 TCCCCCTGATGCTCTCTTGAAGG - Intergenic
1113590100 13:111492713-111492735 TCACCTTGCTGGTCTCTTAAAGG - Intergenic
1116520999 14:45847060-45847082 TCACTTTGAAGGTTTCTTAAGGG - Intergenic
1118768277 14:68924678-68924700 TCACCTAGATGATCCCACAAAGG - Intronic
1121963844 14:98286282-98286304 ACAACTTAATCATCTCTTAAAGG + Intergenic
1125167713 15:36728289-36728311 TCACCTTGAAGAACTGTGAATGG - Intronic
1127314176 15:57778915-57778937 AAACCTTGATCATCTCTTTATGG - Intronic
1130535723 15:84783811-84783833 TTCCCCTGATGATGTCTTAATGG - Exonic
1131603163 15:93870784-93870806 TCACATGGCTGATGTCTTAATGG + Intergenic
1131656791 15:94469423-94469445 TCACCTACATTATCTATTAATGG + Intronic
1132512263 16:349564-349586 TCACCATCATGCTCTCATAAGGG + Intronic
1137811506 16:51357130-51357152 TCACCTTTATGGTCTCTGAGAGG - Intergenic
1137815443 16:51393712-51393734 GTAGCTTGATGATTTCTTAAGGG - Intergenic
1138852394 16:60644489-60644511 TCACTTTGGTGATCTCTGGAAGG - Intergenic
1140783552 16:78318080-78318102 TCCCCTTGGTGTTCTCTAAAAGG - Intronic
1141032549 16:80602372-80602394 TGACCCTCATGAACTCTTAAAGG + Exonic
1142471414 17:165200-165222 TCAGCTTTATCATCTGTTAAAGG + Intronic
1142560835 17:807951-807973 TCACCTTGACCATCTGTTAGGGG - Intronic
1148719312 17:49739493-49739515 TCACCTAGAAGATTTCTTAGGGG - Intronic
1155989150 18:32261136-32261158 TCACCCCGATCAACTCTTAATGG - Intronic
1156342443 18:36222116-36222138 TTACTTTGTTCATCTCTTAATGG + Intronic
1157103559 18:44752010-44752032 TCACCTTGACTACCTCTCAAAGG + Intronic
1157467373 18:47958861-47958883 TCACATTGATCATCTCTTCCGGG + Intergenic
1157884820 18:51356872-51356894 TCACCCTCATGATGTCCTAAAGG - Intergenic
1159626272 18:70698652-70698674 TAACCTTGAAGATGTCTTTAAGG + Intergenic
1165252371 19:34550562-34550584 TAACCTTAATGACCTCTTTAAGG + Intergenic
925898975 2:8494973-8494995 TTGCCTTGATTTTCTCTTAAGGG + Intergenic
928785036 2:34873846-34873868 TCATTTTAATGATCTCATAAAGG - Intergenic
930472741 2:51840739-51840761 TCCACTTGATGATGTCTTATAGG + Intergenic
930688794 2:54337762-54337784 TCACTTTCACCATCTCTTAAAGG - Intronic
937732208 2:125246768-125246790 TCACCTAGATGATCTCTTCTTGG + Intergenic
939408022 2:141784977-141784999 TCACCTATTTGATCTCTTAAGGG - Intronic
942326407 2:174780371-174780393 TCACCATCATGATCACTCAAAGG - Intergenic
944199628 2:197091975-197091997 TCACCAGGATGACCCCTTAAGGG + Intronic
945286805 2:208090849-208090871 TGAACTTACTGATCTCTTAAAGG - Intergenic
945286818 2:208091053-208091075 TAAACTTACTGATCTCTTAAAGG - Intergenic
945986084 2:216354716-216354738 TCAACTTGATGACCTCTTAAGGG - Intronic
946836902 2:223781664-223781686 TCACTTTTATGATCTCTTCTTGG - Intronic
948338665 2:237231551-237231573 TCACATTGATGACATTTTAAGGG - Intergenic
948339236 2:237235789-237235811 TCACATTGATGACATTTTAAGGG - Intergenic
1168984430 20:2035936-2035958 TCACCTTGAACATCCCTTACAGG - Intergenic
1169001089 20:2168553-2168575 TCTCCTGGATCATCTCTAAAAGG + Intronic
1170613827 20:17933928-17933950 TGACCTTGGTGTTCTCTTATGGG - Intergenic
1172063643 20:32204500-32204522 TCACCTTGATCTGCTTTTAATGG + Intronic
1173531454 20:43772751-43772773 TCATCTTAATTATCTCTCAAAGG - Intergenic
1175371097 20:58493335-58493357 TCACAGTCATGATCTCTTAATGG - Intronic
1176263536 20:64196281-64196303 TCACCTTGGTGATCCCTGGACGG - Intronic
1177022881 21:15885043-15885065 TAACCTTAATTATCTCTTTAAGG + Intergenic
949732234 3:7126781-7126803 TCACTTTGTTAATCTCTTCATGG + Intronic
950091549 3:10299238-10299260 TCACCCTGCTGATCTCTCAGAGG + Intronic
950506269 3:13396796-13396818 TCTTCTAGGTGATCTCTTAAAGG - Intronic
951407309 3:22316658-22316680 TCAGCTTGATCATCTATTAATGG + Intronic
955321156 3:57975328-57975350 TTACCTTTATGACCCCTTAATGG - Intergenic
955737798 3:62058243-62058265 TCACCTTAATAATCTTATAAGGG + Intronic
955885560 3:63594762-63594784 TCATCATGATCATCTCTTGAAGG + Intronic
962824933 3:139092205-139092227 TCACTAAGATGATCTCTTGATGG + Intronic
963629515 3:147715256-147715278 TTGCATTGATGATCACTTAAGGG + Intergenic
963746265 3:149127803-149127825 TAACCTTAATTATTTCTTAAAGG - Intergenic
969881432 4:10177393-10177415 TAAACTTGATCATCTCTTACGGG - Intergenic
970269269 4:14326184-14326206 TAACCTTAATTATATCTTAAAGG - Intergenic
970296951 4:14640583-14640605 TCACCTTGCTGATCACTTCTGGG - Intergenic
971547762 4:27909017-27909039 CCACCTTCCTGATCTCTGAACGG + Intergenic
972442919 4:39114402-39114424 TCAACCTGATCACCTCTTAAAGG + Intronic
972956881 4:44403693-44403715 TTAACTTGATTATCTCTTAAAGG + Intronic
973657429 4:53063537-53063559 TCACTTTCCTTATCTCTTAAAGG - Intronic
973993984 4:56438029-56438051 TCACTTTTATGGTCTCTAAAAGG + Intronic
974441754 4:61927422-61927444 TCACCTTGTTTTACTCTTAAAGG + Intronic
975432279 4:74307713-74307735 TCATCTTAATTTTCTCTTAATGG + Intergenic
976513229 4:85934402-85934424 TCAACTTTATGCTCTCTTCAAGG + Intronic
976655113 4:87480451-87480473 TCCCATTGATCTTCTCTTAAGGG - Exonic
977355526 4:95941699-95941721 TGACTTTTATGAGCTCTTAAAGG - Intergenic
979025179 4:115562560-115562582 TAACCTTGATGATATCTGCAAGG - Intergenic
980531213 4:134057616-134057638 TCACCTTAATGCTCCCTTCAGGG - Intergenic
982623933 4:157740896-157740918 ACAACTTGATGATCTTTTTAAGG - Intergenic
984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG + Intronic
984910644 4:184671454-184671476 TTATTTTTATGATCTCTTAAGGG + Intronic
985518661 5:359986-360008 TTTCCTTGATGATCTTTTTATGG + Intronic
986677155 5:10196122-10196144 TCATCTTAATGACCTCCTAAAGG + Intergenic
988758638 5:34289010-34289032 TCACCTTTTTGTTCTCTTAGAGG + Intergenic
988827765 5:34956416-34956438 TCCCCTTCTTGATCTCTTCAGGG + Exonic
990636533 5:57734110-57734132 TCACCTTGATGAAAGCTAAAGGG - Intergenic
991260401 5:64661675-64661697 TCCCCTTGATGATCTCATCTAGG + Intergenic
996951001 5:129126218-129126240 TCAAGTTGATCATCTCTTGAAGG + Intergenic
997409536 5:133680554-133680576 TCTTCTTGATGATCTCATAGAGG + Intergenic
1000012870 5:157249136-157249158 TGACTTTGAGGATCTGTTAACGG + Intronic
1001591931 5:172871554-172871576 TCACCTAGATTATCTCCTAGTGG - Intronic
1005198117 6:23312678-23312700 TAACCTTAATGATCTCCTAAAGG - Intergenic
1005567849 6:27114469-27114491 TCATCTTGATGCTCCCTTCATGG + Intergenic
1006686299 6:35837463-35837485 TCAGTTTGCTGATTTCTTAATGG - Intronic
1010121201 6:72377821-72377843 TAAGTTTGATGATCTCCTAAAGG - Intronic
1011806124 6:91074471-91074493 TCAGCTTATTGATCTTTTAAAGG + Intergenic
1015547340 6:134374882-134374904 TTACCTGCCTGATCTCTTAAAGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1021670430 7:23030122-23030144 TCATCTTCATGATCTATTACTGG - Intergenic
1023007911 7:35894072-35894094 GCAGATTGCTGATCTCTTAAAGG + Intronic
1023015195 7:35961646-35961668 TCAGATTGCTGATCTCTTAAAGG + Intergenic
1023358361 7:39390415-39390437 TCACTGTGATGGTCGCTTAATGG + Intronic
1024065752 7:45733046-45733068 TCAGATTGCTGATCTCTTAAAGG - Intergenic
1025216903 7:57064216-57064238 CCAGATTGCTGATCTCTTAAAGG - Intergenic
1025627789 7:63237573-63237595 CCAGATTGCTGATCTCTTAAAGG - Intergenic
1025654481 7:63506532-63506554 CCAGATTGCTGATCTCTTAAAGG + Intergenic
1028492915 7:91433180-91433202 TCCCTTAGATGATCTATTAAAGG + Intergenic
1030840036 7:114339604-114339626 TCAGGTTGATTATCTCATAAGGG - Intronic
1039049165 8:33477512-33477534 TCATCTTGAGGATCTTTTACTGG - Intronic
1039988039 8:42464417-42464439 TGACCTGGATGATCTGTTGAAGG + Intronic
1040388452 8:46930345-46930367 TGACCTTGATGATCCCTCTAAGG - Intergenic
1042345326 8:67720816-67720838 TCACCTTGTTGATCACTTCCTGG + Intronic
1042621198 8:70706433-70706455 CAACCTTGATATTCTCTTAAGGG + Intronic
1043223696 8:77698267-77698289 TCTCCTGGATAATATCTTAAAGG + Intergenic
1044338670 8:91021048-91021070 TCACCATGAAATTCTCTTAATGG + Intronic
1044374727 8:91456438-91456460 CCACCTTCAAGATCTCTCAAAGG + Intergenic
1045361185 8:101434723-101434745 TCTCCTTGATGACCTCTCAGTGG - Intergenic
1045724392 8:105155226-105155248 TTACCATGATGTTTTCTTAAAGG - Intronic
1046072829 8:109279540-109279562 TTACCTTTTTGTTCTCTTAATGG + Intronic
1046841804 8:118866918-118866940 TCAGCCTCATGATCTGTTAAGGG - Intergenic
1047329701 8:123875620-123875642 TCACCTTGTTCATCTCTAACAGG + Intronic
1047959281 8:129999212-129999234 TCACCTTGCTGCTCTCTCAGAGG - Intronic
1048252752 8:132880248-132880270 TCACCTTCTTAATCTCTAAAAGG + Intronic
1049722402 8:144125271-144125293 TCACCATGATGATTGCTAAATGG - Intergenic
1053027973 9:34747030-34747052 TTACCTTTATACTCTCTTAAAGG - Intergenic
1055361901 9:75500545-75500567 TAACCTTAATGACCTCTTAAAGG + Intergenic
1186303356 X:8226346-8226368 TTACCTTGAAGATATCATAAAGG - Intergenic
1186532477 X:10311232-10311254 ACACCTTGCTGATTTCTTTAGGG - Intergenic
1192971014 X:76230151-76230173 TGACCTTGATGAGATTTTAAAGG + Intergenic
1196622172 X:117836320-117836342 TCACCCTGATGATCTAGGAAGGG - Intergenic
1196904757 X:120420287-120420309 TCTCCTTGAAGAACTGTTAAAGG - Intergenic
1197110950 X:122774249-122774271 TAACCTTAATTACCTCTTAAAGG - Intergenic
1197812740 X:130462182-130462204 TGACTTTGATGATCTCTTTCGGG - Intergenic
1202270841 Y:23072707-23072729 TCACCTTGATTCTATCCTAAGGG + Intergenic
1202295185 Y:23347975-23347997 TCACCTTGATTCTATCCTAAGGG - Intergenic
1202423836 Y:24706451-24706473 TCACCTTGATTCTATCCTAAGGG + Intergenic
1202446953 Y:24963634-24963656 TCACCTTGATTCTATCCTAAGGG - Intergenic