ID: 916156803

View in Genome Browser
Species Human (GRCh38)
Location 1:161858741-161858763
Sequence CTTTTGCATTTTCAGCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 294}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916156803_916156807 27 Left 916156803 1:161858741-161858763 CCATACAGCTGAAAATGCAAAAG 0: 1
1: 0
2: 3
3: 32
4: 294
Right 916156807 1:161858791-161858813 TAGTTAATTGGTATAAATCTTGG 0: 1
1: 0
2: 2
3: 18
4: 196
916156803_916156804 -1 Left 916156803 1:161858741-161858763 CCATACAGCTGAAAATGCAAAAG 0: 1
1: 0
2: 3
3: 32
4: 294
Right 916156804 1:161858763-161858785 GCTCATGACTAGTTTTTCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 97
916156803_916156805 15 Left 916156803 1:161858741-161858763 CCATACAGCTGAAAATGCAAAAG 0: 1
1: 0
2: 3
3: 32
4: 294
Right 916156805 1:161858779-161858801 TCAGAGGTTCCTTAGTTAATTGG 0: 1
1: 0
2: 0
3: 4
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916156803 Original CRISPR CTTTTGCATTTTCAGCTGTA TGG (reversed) Intronic
900075127 1:808450-808472 CTTTTGCAATATCAGATCTATGG - Intergenic
901984638 1:13064843-13064865 CTTTTGTATTTTTAGCAGAAAGG + Intronic
901997172 1:13161927-13161949 CTTTTGTATTTTTAGCAGAAAGG - Intergenic
903214086 1:21833607-21833629 CTAGTGCATTTGCAGCTGGATGG - Exonic
907088232 1:51699035-51699057 CTCTTGAATTTTCAGCTGGAAGG + Intronic
907195154 1:52680550-52680572 ATTTTGCTTATTCAGCTGTCTGG + Intergenic
907207389 1:52785387-52785409 CTTTTCCATTTCTAGCAGTATGG + Intronic
907455006 1:54569817-54569839 CTTTTTCATTTTCATCTGCTTGG + Intronic
908095845 1:60737541-60737563 CTTGTGCTCTTTCATCTGTATGG + Intergenic
909075931 1:71050514-71050536 ATTATACATTTTAAGCTGTAGGG - Intergenic
909136340 1:71805033-71805055 CTTTTACAGTCGCAGCTGTAGGG + Intronic
909532469 1:76696260-76696282 TTTATTAATTTTCAGCTGTAAGG - Intergenic
909733193 1:78922334-78922356 CATTTGCATTTCCAACTGTTTGG - Intronic
909998444 1:82311225-82311247 CTTTTTAATTTTTAGGTGTATGG + Intergenic
910280579 1:85496268-85496290 CATTTGCAGTTTCATCTGTATGG - Intronic
910551378 1:88479541-88479563 AATTTGCATGTTCAACTGTAGGG - Intergenic
911856443 1:102883424-102883446 CTTTTGCCTTTTAAGCTTTTGGG + Intronic
912843482 1:113059570-113059592 TTTTTGCATTTTCAGCTAGCTGG - Intergenic
915683597 1:157607133-157607155 TTATTGCATTTTCAGCTCCAGGG - Intergenic
916156803 1:161858741-161858763 CTTTTGCATTTTCAGCTGTATGG - Intronic
916266058 1:162890896-162890918 CTTTTGCATTTTTAGTAGCAAGG + Intergenic
917099717 1:171432761-171432783 CATTTGCATTTGTATCTGTAGGG - Intergenic
918678132 1:187316051-187316073 TTTCTGTATTTTCAGCTTTATGG + Intergenic
919783836 1:201243926-201243948 CTTTTGAATTTCCAAATGTATGG - Intergenic
920123967 1:203678853-203678875 CCTTTGTATCTTCATCTGTAAGG + Intronic
921616142 1:217270119-217270141 TTTTTGCATTGTCAGGTGGATGG + Intergenic
922019683 1:221691114-221691136 CATTTCCATTCTCAGCTGAAAGG - Intergenic
922270967 1:224033349-224033371 CTTTTGCAATATCAGATCTATGG - Intergenic
923113373 1:230911104-230911126 CTTTTCCATTTTGGGCTGTCAGG - Intronic
924073485 1:240308234-240308256 CTTGTGCCATTTCAGCTGTGTGG - Intronic
924357179 1:243192225-243192247 CTTTTGCATATTCTGCTGTATGG - Intronic
924490028 1:244527240-244527262 CTTTTACGGTTGCAGCTGTAGGG - Intronic
1063408025 10:5814690-5814712 CTGTTGCATAATCAGTTGTATGG - Intronic
1063802750 10:9599308-9599330 CATGTGAATTTTCAGCTGTAAGG + Intergenic
1065816118 10:29484273-29484295 CTTTTGCACTTTCAGATCAATGG + Intronic
1065956784 10:30700623-30700645 CTTTTGCACTTTCAGATCAATGG - Intergenic
1068259230 10:54556626-54556648 CTTTTTTTTTTTCGGCTGTAGGG + Intronic
1068268731 10:54690679-54690701 ATTTTGCATTTTAAGCTGTGGGG + Intronic
1068270212 10:54713798-54713820 GTTTTGCCTTTTCAGGTCTAGGG - Intronic
1068442063 10:57069578-57069600 ATTTTGCATTTTCCGCAATAAGG - Intergenic
1068626914 10:59259334-59259356 TTAATGCATTTTCAGCAGTAAGG + Intronic
1069289250 10:66756886-66756908 GTTTTGCAATTTCTGCTCTAGGG - Intronic
1071195263 10:83151814-83151836 ATTTTGGATTTTGAGCTGTGTGG + Intergenic
1071945440 10:90638702-90638724 CTTTTACAGTTGCAGCTGTAGGG + Intergenic
1075234678 10:120716203-120716225 CTTTTGCCCTCTGAGCTGTAAGG + Intergenic
1075885768 10:125897709-125897731 CATTTGCATTTACAGCTCTTTGG + Intronic
1076040653 10:127245267-127245289 GTCTTGCTTTTTCAGCTCTAAGG - Intronic
1076454391 10:130579254-130579276 CTTTCCCATTTTCAGTTGCAAGG - Intergenic
1079529428 11:21432219-21432241 TTTTTGACTTTTCAGCTGTTTGG + Intronic
1080038974 11:27738928-27738950 CCTTTTTATTTCCAGCTGTATGG + Intergenic
1080070046 11:28071882-28071904 CTTTAGCATTTACAGTCGTAGGG + Intronic
1080702204 11:34653419-34653441 CTTTTGCATTTGCAGTAGCAAGG + Intronic
1081108121 11:39098814-39098836 TTCTTGCTTTTTCAGCTGAAAGG + Intergenic
1082638704 11:55628489-55628511 GTTTTGTTTTTTCAGCTGTGTGG + Intergenic
1083386836 11:62317300-62317322 CTGCTGCATTGTCAGCTGTGTGG - Intergenic
1083647979 11:64184173-64184195 GTTTTGCATTTTCAATTGTGGGG - Intergenic
1084350916 11:68598512-68598534 CTTTTGCATCTTCAGATCTCTGG + Intronic
1084469277 11:69346423-69346445 CTTGTCCTTCTTCAGCTGTAAGG + Intronic
1085010680 11:73139916-73139938 CTTTTGGATTTCCTGCTTTAAGG - Intronic
1086013101 11:82129784-82129806 TTTTTGCATTTTCAGCAGTTTGG + Intergenic
1086819122 11:91413304-91413326 ATTTTGCATTTGCACCAGTAGGG - Intergenic
1087418768 11:97893115-97893137 ATTTTACATTTGCAGGTGTAAGG - Intergenic
1089387957 11:118080174-118080196 CTATTGCTTTTTCAGCTCCAGGG - Intronic
1092885570 12:12921801-12921823 CATTTCCATTTTCACCTGAAGGG - Intergenic
1093623316 12:21318050-21318072 TATTTGCATTTTCATTTGTAAGG + Intronic
1094092625 12:26668138-26668160 CATTTGCTTTTTAAGCTTTATGG + Intronic
1096467762 12:51856749-51856771 CTTTACCATTTACAGCTTTACGG - Intergenic
1097982482 12:65748687-65748709 AATTTGCATGTTCAGTTGTAGGG - Intergenic
1098247036 12:68530672-68530694 ATTTTGTATTTTCAGCTGGAGGG - Intergenic
1098475997 12:70904100-70904122 ATTTTGCATTCTCACCTGCAAGG - Intronic
1099364673 12:81753585-81753607 ATTTTTCATTTTCAGTTGTGTGG - Intronic
1101130958 12:101690687-101690709 CTTTTGCAATTTCAGATAAAGGG + Intergenic
1101310392 12:103573614-103573636 CTTTGCCATTCTCAGCTGTGTGG + Intergenic
1101797517 12:107989331-107989353 CTTCTGCATTCTCATCTGAAAGG + Intergenic
1102423538 12:112823010-112823032 CTTTTGAAGTTGCAGCTGCAGGG + Intronic
1103502504 12:121414080-121414102 CTTTTGCATTTTAAGGTTGAGGG + Intronic
1105395267 13:20027285-20027307 CTTTTGCAATTCCAGTTGTGTGG + Exonic
1107142580 13:37018007-37018029 TTTTTCCATTTTAAGCTATAGGG + Intronic
1107196185 13:37654694-37654716 CTTTTGTATCTTCCCCTGTAGGG + Intronic
1109066040 13:57692849-57692871 ATTATGTATTTTCAGCAGTAAGG + Intronic
1110064750 13:71089248-71089270 CTTTTGCAATTTCCTCTGCATGG - Intergenic
1110655172 13:77989209-77989231 CTTTTGAATTTTCAGTAGAAGGG + Intergenic
1111771956 13:92608199-92608221 TATTTGGATTTTCAGCTGCATGG + Intronic
1112135754 13:96576057-96576079 CTTTTGCATTTTCTCCTGCCAGG + Intronic
1112500044 13:99935810-99935832 TTTTTCCTTTTTTAGCTGTAGGG - Intergenic
1112676333 13:101706449-101706471 CATTTGCATTTTTATCAGTATGG - Intronic
1113426023 13:110209385-110209407 CTTTTACCTTTTCACCTGGAGGG + Exonic
1114368626 14:22059129-22059151 CTTTTGCCATATCAGCAGTAAGG - Intergenic
1114495518 14:23128927-23128949 CCTTTGATTTTTCAGCTGGAAGG + Intronic
1115483916 14:33890483-33890505 CTTTTGCATTATATGCTATAGGG - Intergenic
1115683694 14:35770500-35770522 CCTTTGGATTTTCTACTGTAGGG - Intronic
1116826071 14:49674913-49674935 CTTGTGCATTTTCATCTCAAGGG + Intronic
1117613786 14:57511617-57511639 TTTTTGAATTTTCAGGTGTTTGG + Intergenic
1118427100 14:65677809-65677831 TTTTTACATTTACAGATGTATGG - Intronic
1118841813 14:69519195-69519217 CTTTTGTATTTATAGCTGTCAGG + Intronic
1121293377 14:92795373-92795395 TTTTTAGATTTTGAGCTGTATGG + Intronic
1122046503 14:99027724-99027746 CTATTGCATTTGCTGCTTTAGGG + Intergenic
1122257453 14:100489269-100489291 CTCTTGCATTTCCAGCTTTGCGG + Intronic
1122348255 14:101073538-101073560 CTTTTGCATTTGCAGCAGAGCGG - Intergenic
1122402421 14:101475354-101475376 CTTTTCCCCTTGCAGCTGTAAGG - Intergenic
1124341222 15:28890302-28890324 TTTTTGGATTTTCAGTTGTTTGG + Intronic
1124579556 15:30941569-30941591 CATTTCCATTTTCTCCTGTAGGG - Exonic
1124965893 15:34433404-34433426 TTTTTGGATTTTCAGTTGTTTGG - Intronic
1124982511 15:34579503-34579525 TTTTTGGATTTTCAGTTGTTTGG - Intronic
1125107523 15:35990570-35990592 CTTTCTCTTTTTCAGATGTATGG - Intergenic
1125875740 15:43142637-43142659 CATTAGCATTTTTAGCAGTAAGG + Intronic
1126872027 15:52999971-52999993 CTCTGTCATTTACAGCTGTAAGG - Intergenic
1127676367 15:61243039-61243061 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
1128010284 15:64288255-64288277 TTTTTACATTTACAGCTTTATGG - Intronic
1128357678 15:66939651-66939673 CTTCTGCCTTTTCATTTGTAAGG + Intergenic
1132173671 15:99690017-99690039 ATTTTGGATTTTCAGGTTTAGGG + Intronic
1133391848 16:5416984-5417006 CTTTTTCATTTTCAGCGGGCTGG - Intergenic
1133934830 16:10260293-10260315 CTTTTGCTTTTTCATCTCTTAGG - Intergenic
1135687546 16:24510245-24510267 CATTTGCATTTTCAACTGCATGG + Intergenic
1135688557 16:24517742-24517764 CATTTGCATTTTCAACTGCATGG - Intergenic
1137828707 16:51523621-51523643 CTTTTGTGTTTTCTGCTCTAAGG + Intergenic
1138868898 16:60856705-60856727 CTTCTGCGTTGTCAGCTGTAAGG + Intergenic
1138985873 16:62327985-62328007 CTTCTGCATTTTCAGGAGTGAGG + Intergenic
1139612587 16:68069685-68069707 CTTTGGCATTGGCAGCTGTGTGG + Intronic
1145213195 17:21031250-21031272 CATTTGTATTTTCAGCTCTGCGG - Intronic
1146143062 17:30386363-30386385 CTTTTGTATTTTAATCTGTGAGG + Intronic
1146447439 17:32943679-32943701 CCTTAGCATTCTCATCTGTATGG + Exonic
1146548684 17:33761775-33761797 GGTTTGTATTCTCAGCTGTAGGG - Intronic
1146954134 17:36927047-36927069 ATTTTGCATTTTCAGCTTGTAGG - Intergenic
1147320404 17:39642483-39642505 CTTGTGCATGTGCTGCTGTAGGG + Intronic
1148605068 17:48922969-48922991 CTTTTACATGGCCAGCTGTAGGG - Intronic
1151216181 17:72578053-72578075 CATGTGGATTTTCAGCTGCACGG + Intergenic
1152164204 17:78691380-78691402 CCTTGGCATTTTCTGCTGTGAGG - Intronic
1154034595 18:10788020-10788042 CTTTTGCATTTCAGGCTTTAGGG - Intronic
1155444661 18:25898659-25898681 CTTTGGAGTTTTCAGCAGTATGG + Intergenic
1155632452 18:27909019-27909041 ATTTTTCATTTTCACCAGTAAGG + Intergenic
1155812887 18:30260502-30260524 CCTTGCCATTTTCACCTGTAGGG - Intergenic
1156506660 18:37600156-37600178 CTTTTGTATTTGGAGCTGGAGGG - Intergenic
1156891292 18:42192167-42192189 ATTTTTTATTTTCAGCTTTAGGG + Intergenic
1157380203 18:47207488-47207510 CTTTAGCCTTCTCAGCTGTAGGG + Intergenic
1157673890 18:49553743-49553765 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
1159686188 18:71423849-71423871 CTTTTACAGTCGCAGCTGTAGGG + Intergenic
1159844458 18:73441886-73441908 AATTTGAATTTTCAGGTGTATGG + Intergenic
1160495982 18:79375699-79375721 TATTTGCCTTTTCAGTTGTAGGG + Intronic
1164407845 19:27970494-27970516 CTATTGCAAATTCAGCTGTTAGG - Intergenic
1165256787 19:34581345-34581367 CATTTGCATTTTCTGGTGTAAGG + Intergenic
925870158 2:8263386-8263408 CAGTTTCATTTTCACCTGTATGG + Intergenic
926284314 2:11475672-11475694 CTTTTGCATTTTCTGTGGTAGGG + Intergenic
926556323 2:14362371-14362393 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
926859120 2:17290480-17290502 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
926922676 2:17954633-17954655 CCCTTGCATTTTCAGCTATGTGG + Intronic
926929307 2:18021437-18021459 CTTGTGGAATTTCAGCTGAAAGG + Intronic
927720531 2:25379164-25379186 CTCTTGCATCTTCACCTGTTAGG + Intronic
929550706 2:42889540-42889562 TTCTTGCATTTTCAGTTGTATGG + Intergenic
931365960 2:61619286-61619308 CTTGTCCATTTTCAGCTTTAGGG - Intergenic
931806687 2:65814150-65814172 GTTTTGCATTTTAAGCTGATGGG + Intergenic
932244211 2:70182802-70182824 CTTCTGAAGTTTGAGCTGTATGG + Exonic
932256202 2:70289365-70289387 CTTTTCCTTTTTCAGATTTATGG - Exonic
932702960 2:74003367-74003389 TTTTTGCTTTCTCAGCTGGATGG + Intronic
933611863 2:84444719-84444741 CTTTTGTGGTTGCAGCTGTAGGG - Intronic
933721200 2:85398713-85398735 CATTTGCCTTGTCAGCTGTGAGG + Exonic
933976163 2:87513186-87513208 CTTTTGCATTTTAAGCTTAAAGG + Intergenic
934062538 2:88308669-88308691 CTTTGGTATTTTCAGATTTATGG - Intergenic
935566777 2:104617384-104617406 TTGTGACATTTTCAGCTGTATGG - Intergenic
935756685 2:106281862-106281884 CTTTTGCATTTTGTGCTTTTGGG + Intergenic
936317659 2:111437618-111437640 CTTTTGCATTTTAAGCTTAAAGG - Intergenic
937139792 2:119590260-119590282 ATTTTGCATTTTCTTCTGAAAGG + Intronic
938015467 2:127863516-127863538 CTTTTGCATTTTCTTCTGTCAGG - Exonic
938122385 2:128643085-128643107 CTTTTGCTTCTCCAGCTCTAGGG + Intergenic
939495512 2:142923290-142923312 CATTTTCATTTTCAACTCTATGG + Intronic
939636508 2:144589582-144589604 GGTTGGCATCTTCAGCTGTACGG - Intergenic
940462940 2:153990755-153990777 GTTTTGCTTTGTAAGCTGTATGG - Intronic
940988208 2:160071000-160071022 CTTTTGCACTCTCTGCTGTATGG - Intergenic
941152394 2:161931098-161931120 TTTTTGTATTTTCAGCAGAAAGG + Intronic
941744426 2:169071453-169071475 ATTTTGCATTTTTAGTTCTAAGG - Intronic
942217159 2:173732602-173732624 CTTTTACATTTGCACTTGTAGGG - Intergenic
942478304 2:176353179-176353201 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
942708912 2:178809816-178809838 CATTTGAATTATCAGCTGTTTGG - Intronic
944674697 2:202025569-202025591 CTTGTGCAGTTGCAGCTGTCAGG + Intergenic
945008445 2:205435519-205435541 CTTTTTTATTTTCTGCTATATGG + Intronic
945125571 2:206505892-206505914 CCTTTGCACTTGCAGCTATATGG - Intronic
945247855 2:207736726-207736748 TTTTTGCTTTTTAAGCTGTTAGG - Intronic
946749399 2:222878628-222878650 CCTCTGCATCTTCAGCTGTTTGG + Intronic
947133174 2:226950867-226950889 CTAATGCATTATCAGATGTATGG + Intronic
949082595 2:242116334-242116356 CTTTTGCAATGTCAGATCTATGG + Intergenic
1169407346 20:5333506-5333528 CTTTTTCATTTTCTGATGAAGGG + Intergenic
1169415153 20:5409685-5409707 AGCTTGAATTTTCAGCTGTATGG - Intergenic
1170487260 20:16830936-16830958 CTATTTCATTTCCAGCTGAAGGG + Intergenic
1170571190 20:17633747-17633769 CTTTTCCATTATCAGCTGTGTGG + Intronic
1170603659 20:17860195-17860217 GATTTTCATTTTCAGCTTTATGG - Intergenic
1170861380 20:20106806-20106828 GTTTTCCATTTTCAGATGGAAGG + Intronic
1173230375 20:41191635-41191657 TTTTTGCATTTGCATTTGTAAGG + Intronic
1173867885 20:46324095-46324117 CTTCTGACTTTTCATCTGTAAGG + Intergenic
1177302981 21:19274079-19274101 TTATTAAATTTTCAGCTGTAAGG - Intergenic
1177749109 21:25257394-25257416 CTTTTGCTTTTCTATCTGTAAGG - Intergenic
1178392698 21:32212385-32212407 ACTTTGCATTCTCAGCTGCAAGG + Intergenic
1178698578 21:34815309-34815331 CATTTTAATTTTCAGCTGAATGG - Intronic
1179079076 21:38153507-38153529 CTTTTGCAATGCCAGCTGAAAGG - Intronic
1180285797 22:10743241-10743263 CATTTGCATTTACAGCTCTTTGG + Intergenic
1183809327 22:40240788-40240810 CATTTGCATTTGTTGCTGTATGG + Intronic
949264030 3:2136130-2136152 CTTTTGTATTTGGAGGTGTAAGG + Intronic
950895507 3:16446709-16446731 GTTTTCCATTTTCTGCTGTTTGG - Intronic
951659325 3:25045139-25045161 CTTTTGCTATTCCAGCTGTTAGG - Intergenic
956440017 3:69270984-69271006 ATGTTGTATTTTCAGCTGAATGG + Intronic
956495131 3:69817164-69817186 GTTTTGCTTTTTAAGCTGTGTGG + Intronic
956669517 3:71673125-71673147 CTTATGCATTTTCAGCAGTTTGG - Intergenic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
959350004 3:105250098-105250120 CCCTTGCATTTTCAGCTCCATGG - Intergenic
959423489 3:106156545-106156567 CTCTTGCATCTTCAGCCCTAGGG - Intergenic
960112848 3:113862280-113862302 CTTTTACAGTCACAGCTGTAGGG - Intronic
963221141 3:142813347-142813369 CTTTTTCCTTTTCAGCTGGGAGG + Intergenic
963995211 3:151700974-151700996 CTTTTGCCTTTTCAGATGTCAGG + Intergenic
964624894 3:158749371-158749393 CTTTTGAGTTTTCAGCTTCAGGG - Intronic
964810662 3:160660417-160660439 CTTTTGAATTCTCATCTGTTGGG + Intergenic
966348730 3:179006188-179006210 CAATTGCATTTTCAACTGTAAGG - Intergenic
967653244 3:192012786-192012808 CTTTTGTTTTCTCAGCTATAAGG + Intergenic
967819491 3:193827702-193827724 CTTTTTAATTTTTAGCTTTATGG + Intergenic
970874794 4:20857088-20857110 CTCTTGCTTTTCCAGCTGTCTGG + Intronic
973053678 4:45628172-45628194 CTTTTTTATTTTTAACTGTATGG + Intergenic
974214745 4:58829999-58830021 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
975994146 4:80295056-80295078 CTTTTCCAATCCCAGCTGTAAGG - Intronic
976077706 4:81318368-81318390 CTTTTGTTTTTCCAGCTGAATGG + Intergenic
976391650 4:84511713-84511735 CTTCTGACTTTTCTGCTGTAAGG - Intergenic
976559613 4:86486362-86486384 CTTTTTCTTTTTCTTCTGTATGG - Intronic
978020231 4:103800289-103800311 TTTTAGCATTTTCAAATGTAAGG - Intergenic
979244636 4:118487375-118487397 CTTTTGCATATTCTGCTGTATGG + Intergenic
980314062 4:131173681-131173703 TTTTTGCATTTTCTGCACTAAGG - Intergenic
982059430 4:151589484-151589506 CTTTTCCATTGTGAGCTGTCAGG + Intronic
982963636 4:161873774-161873796 ATTTTGCATTTTTAACTTTATGG + Intronic
983875269 4:172867775-172867797 CTTTCTCTTTTTCAGCTATAGGG + Intronic
984219997 4:176963283-176963305 CTTTTTCATTGCCAGCTGGAAGG + Intergenic
985044193 4:185923710-185923732 CTTTTTCATTTACAAATGTAGGG - Intronic
985229150 4:187796501-187796523 CTTTAGCATTTTCAGCTAGGTGG - Intergenic
986786120 5:11115353-11115375 TTATTTTATTTTCAGCTGTAAGG + Intronic
987236745 5:15950384-15950406 TTTTTGCTGTTTCAGCTGTCTGG - Intergenic
987452269 5:18100874-18100896 CTTTTGCCTTTTCCCCTCTAAGG + Intergenic
987845439 5:23277391-23277413 CTGTGGCATTTTCAGGTGTAGGG - Intergenic
989238721 5:39179401-39179423 CTTTTCCATTTTCAGGAGTCAGG + Intronic
990193734 5:53290056-53290078 CTTTTGTTTTCTCAGCTTTAAGG + Intergenic
990384329 5:55245018-55245040 CTTTTTAATTTTGAGCTGTATGG + Intergenic
991411299 5:66348041-66348063 CTATTGCACTGTCAGCTGGAAGG - Intergenic
991519373 5:67478651-67478673 CTTTTTTATTGTCAGCTGTAGGG - Intergenic
993018263 5:82561861-82561883 TTTTTAAATTTTCAGCTGCATGG + Intergenic
993240935 5:85384018-85384040 TTTTTTAATTTTCAGTTGTATGG + Intergenic
994592615 5:101791304-101791326 GTTTTGAATTTACAGCTGGAGGG - Intergenic
995990835 5:118237600-118237622 CTTCTGCATTTTCTGATGTGGGG - Intergenic
997101849 5:130978618-130978640 CTTTTTCTTTTTCAGCTGCCTGG + Intergenic
999741556 5:154558685-154558707 CTATTGACTTTTCAGCTATACGG + Intergenic
1000004438 5:157170113-157170135 CTTTTACAGTCGCAGCTGTAGGG + Intronic
1000126289 5:158247017-158247039 CATCTACATTTTCAGCTCTAGGG + Intergenic
1000197820 5:158976806-158976828 ATTTTGTATTTTTATCTGTATGG + Intronic
1000419986 5:161027868-161027890 CTTGTCTATTTTCAGCTGAATGG + Intergenic
1003539217 6:7003346-7003368 TTTTTCCATTTTCAGATGTGTGG - Intergenic
1004778244 6:18873247-18873269 CTTTTACGGTCTCAGCTGTAGGG + Intergenic
1006013472 6:31061837-31061859 CTTTGGCCTTTTCATCTGGAAGG - Intergenic
1008170717 6:48202323-48202345 CTTTTACAGTCACAGCTGTAGGG + Intergenic
1009305040 6:62077994-62078016 CGTGTGCATTTTCAAATGTATGG - Intronic
1010731883 6:79399803-79399825 ATTTTGCTTCTTCAGCTGAAAGG - Intergenic
1011570751 6:88731769-88731791 CATGTGGATTTTCAGCTGCATGG - Intronic
1012455102 6:99394769-99394791 CTCTTGCATTCTTAGCAGTAGGG - Intergenic
1014489075 6:122039422-122039444 ATTTTACATTTTCATCAGTAGGG - Intergenic
1014521945 6:122455043-122455065 CTGGTGCGTTTTCAGTTGTAAGG + Intronic
1015093921 6:129391483-129391505 CTTTTTCATTTACAGCTGCAGGG - Exonic
1016329525 6:142943050-142943072 CATTTGCATTGTGAGCTGAAAGG - Intronic
1017547497 6:155468047-155468069 CTGTGGCTTTTTCAGGTGTACGG + Intergenic
1020062968 7:5166387-5166409 TCTTTGCATCTTCAGATGTATGG + Intergenic
1020093544 7:5355011-5355033 CTTTTGCATTGGCAGCTGCCTGG - Intronic
1020165279 7:5802777-5802799 TCTTTGCATCTTCAGATGTAGGG - Intergenic
1020457349 7:8389174-8389196 CTTTTACATTCTCATCTGTCAGG - Intergenic
1020607159 7:10353865-10353887 TTTTTGCATTTTTAGTAGTAAGG - Intergenic
1020787183 7:12587915-12587937 GTTTTGCATCTTAAGCAGTACGG - Intronic
1021499078 7:21309659-21309681 CTTATGCATTTTCAGCAGAAAGG - Intergenic
1021860838 7:24904630-24904652 CTGTTGTATGTACAGCTGTATGG - Intronic
1023351691 7:39326785-39326807 GTTATGGATTTTCAGCTGTGAGG - Intronic
1023369151 7:39495580-39495602 GTTTGGCTTTTTCACCTGTAGGG - Intergenic
1023612981 7:41990084-41990106 CATTTGCACTTTTAACTGTAGGG + Intronic
1028091058 7:86702186-86702208 CCTTTTCATTTTCTGTTGTATGG - Intronic
1032184045 7:129708080-129708102 CTTTTTGGTTTTCAGCTGCAGGG + Intronic
1032237686 7:130139636-130139658 CTTTTGCATTTGAGGCTGCAAGG - Intergenic
1032903492 7:136337731-136337753 CTTTTCCATCTTCAGCTGTATGG - Intergenic
1033953847 7:146819154-146819176 CTTTTAAATTTTCATCAGTAAGG - Intronic
1035540521 8:433037-433059 CTTTTGCAATATCAGATCTATGG + Intronic
1036537830 8:9668879-9668901 ATTTTGACTATTCAGCTGTAGGG + Intronic
1037124478 8:15330023-15330045 CTAATGCATTTTCAGATGTTGGG - Intergenic
1037307198 8:17517668-17517690 CTATTACATTTTCAGTTTTAAGG + Intronic
1038079276 8:24114920-24114942 CTTTGACATTTTCAGCTCGAGGG + Intergenic
1038091960 8:24264098-24264120 TTCTTGCATTTTCAGTTGTTTGG + Intergenic
1038505042 8:28076801-28076823 CTCTTTTATTTGCAGCTGTAAGG - Intronic
1038868227 8:31463177-31463199 CTTTTGCCTCTTAAGCTATAAGG - Intergenic
1041038917 8:53826200-53826222 ATTTTGCATTTTCATCAGCAGGG - Intronic
1042739199 8:72024603-72024625 CTTTTTCATTTTTTCCTGTAGGG + Intronic
1042817283 8:72891500-72891522 CTTTTGTAATTTAAGCTGAATGG - Intronic
1043169244 8:76943961-76943983 GTTTTTCATTTTCATTTGTATGG + Intergenic
1043754833 8:83990098-83990120 CTTGTGCAGTTTCAGCTGAGGGG + Intergenic
1044463756 8:92479819-92479841 CTTTTGCAGTTTCCGCAGTTTGG - Intergenic
1045187020 8:99848564-99848586 TTTTTCAATATTCAGCTGTAAGG - Intronic
1046872733 8:119221572-119221594 CTTTTTCTCTTTCAGCTGTTCGG + Exonic
1047981522 8:130188176-130188198 CCTTTGCTTTTTCAGCTCCAGGG - Exonic
1048086834 8:131190528-131190550 CTTCTGCTTTTTCAGATGTTAGG + Intergenic
1048159937 8:132008202-132008224 CTTTTTATTTTTCAGTTGTAGGG - Intronic
1048787930 8:138071316-138071338 ATTTTGCATTTTCATCAGCAAGG - Intergenic
1050644821 9:7708013-7708035 CTTTTCCTTTCTCAGCTGCATGG + Intergenic
1050782893 9:9361225-9361247 CCTGGGCATTTTCAACTGTAAGG - Intronic
1051031205 9:12681555-12681577 CTTAAGCATTTTTAGATGTACGG + Intergenic
1051032936 9:12704725-12704747 CTTTTGCATGCTCAGCTGGGCGG + Intronic
1051948800 9:22605247-22605269 CTTCTACATTTTCTTCTGTAAGG + Intergenic
1055352994 9:75408447-75408469 CTTTTGAATTTTCAGCTTGCAGG + Intergenic
1055895402 9:81168763-81168785 CTTTTGTTTTTTCACATGTAAGG + Intergenic
1056045382 9:82710105-82710127 AATTTTCATTTTCAGCAGTATGG - Intergenic
1056549363 9:87638906-87638928 CTTTTGCATTTCCAGCTCCCAGG - Intronic
1057581240 9:96289600-96289622 CATTTGCATTTTCAGCACAAAGG + Intronic
1058400349 9:104610165-104610187 CTTTTCCATTTTCAGGTTCAAGG + Intergenic
1058777420 9:108298244-108298266 CTTCTGCATTCTCATCTGTAAGG - Intergenic
1185531863 X:826764-826786 CTTTTGAACGTTCAGCTGTCTGG + Intergenic
1186529467 X:10280608-10280630 CATTGGCATTTTCAGATGTAGGG - Intergenic
1187743267 X:22379648-22379670 CTTTTGCATTTTCTACTTTCTGG + Intergenic
1187744444 X:22393240-22393262 CTTTTGCATTCACATATGTATGG - Intergenic
1188160739 X:26799201-26799223 ATTTTACATTTTTAGCTTTAGGG + Intergenic
1189498070 X:41527839-41527861 CTATTACAGTTTCAGCTTTAGGG + Intronic
1189788037 X:44577257-44577279 CTTTTGCATTCACAACTGTTGGG - Intergenic
1193018938 X:76769238-76769260 ATTTTGCATTTTTAACTGGAAGG - Intergenic
1193542095 X:82784966-82784988 CTTTAGCAGTCTCAGCTGTAAGG - Intergenic
1193796355 X:85879582-85879604 CTTTTGCATTTACAGAGTTATGG + Intronic
1193851535 X:86543366-86543388 CTGTTTCTTTTTCATCTGTAGGG - Intronic
1197160238 X:123314575-123314597 GCTTTGCATTGTCAGCTGAAAGG - Intronic
1197647002 X:129028455-129028477 GTGTTGCATTTTCTTCTGTAAGG - Intergenic
1198049067 X:132931035-132931057 CTTTAGAATTTTCACCGGTATGG - Intronic
1198145291 X:133850239-133850261 CTTTTTCATCTTAAACTGTAAGG - Intronic
1198573376 X:137983036-137983058 CTGTTGTGTTGTCAGCTGTAAGG + Intergenic
1199367836 X:147007856-147007878 TTTATGCATTTTTAGTTGTAGGG + Intergenic
1199477011 X:148257022-148257044 CTTTTACGGTTGCAGCTGTAGGG - Intergenic
1199561574 X:149169098-149169120 CTTTTACAGTCGCAGCTGTAGGG - Intergenic
1200546357 Y:4523953-4523975 CTTCTGCAGTTTAAGTTGTATGG - Intergenic
1201242335 Y:11971003-11971025 CTTCTCCATTTCCAGCTGTTTGG - Intergenic
1201558763 Y:15292572-15292594 CTCTTTCATTTCCAGCTGTAGGG + Intergenic