ID: 916158608

View in Genome Browser
Species Human (GRCh38)
Location 1:161885481-161885503
Sequence AGCTGTATGCTATTGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916158605_916158608 0 Left 916158605 1:161885458-161885480 CCACAGTCAAAAGCAGAATGTGA 0: 1
1: 0
2: 4
3: 21
4: 256
Right 916158608 1:161885481-161885503 AGCTGTATGCTATTGATGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916158608 Original CRISPR AGCTGTATGCTATTGATGGG AGG Intronic
901209509 1:7516491-7516513 AGCTGGATGCTTTGGATGGCTGG + Intronic
903169412 1:21542844-21542866 AGCTGTATTTTTTTGGTGGGGGG - Intronic
909450605 1:75794089-75794111 AGATGTATGCTACTCATGGTGGG + Exonic
910637564 1:89425856-89425878 GGCTGTATACAATTAATGGGGGG + Intergenic
911477780 1:98395018-98395040 AGGAGTATGATATTGATGAGAGG - Intergenic
913217240 1:116630919-116630941 AGCAGTTTGACATTGATGGGTGG + Intronic
913366100 1:118040764-118040786 ACCTGTATCCTTCTGATGGGGGG - Exonic
914446632 1:147756469-147756491 ACTTGGATGCTATTGTTGGGTGG - Exonic
914778331 1:150759244-150759266 GGCTGTGTGCTTTTGATTGGAGG + Intronic
914997218 1:152554689-152554711 AGCTTTGTGCTATTTATGTGGGG - Intronic
916158608 1:161885481-161885503 AGCTGTATGCTATTGATGGGAGG + Intronic
918719938 1:187840079-187840101 TGCTGTCTTCTATTCATGGGTGG - Intergenic
922762690 1:228142462-228142484 AGCAGTAAGCTATTGAGGTGAGG - Intronic
924938030 1:248788927-248788949 AGCTCTATGGAAGTGATGGGTGG - Intergenic
1063106101 10:2993729-2993751 AGCTGTGTTCTCTGGATGGGTGG - Intergenic
1063627142 10:7700769-7700791 AGCTGAATGCTATAAATGTGAGG + Intergenic
1065295537 10:24270893-24270915 TGCTGTATGATATAGGTGGGGGG - Intronic
1067236128 10:44451798-44451820 ATCTGTCTGATATTGATAGGGGG + Intergenic
1075659913 10:124186076-124186098 AGTTCTAAGCTATTAATGGGAGG + Intergenic
1078528999 11:12121891-12121913 AGTTTAGTGCTATTGATGGGAGG + Intronic
1080559467 11:33449699-33449721 ATGTGTCTGCTTTTGATGGGAGG - Intergenic
1090847763 11:130545483-130545505 AGCTGTAAGCTACTTATAGGGGG - Intergenic
1093386967 12:18569023-18569045 AGCTGCCTCCTCTTGATGGGAGG - Intronic
1098634010 12:72758214-72758236 AGTTGTGGGCTATGGATGGGTGG - Intergenic
1101270520 12:103138924-103138946 AACTGCATGATATTGATGGTAGG - Intergenic
1101279815 12:103241258-103241280 AGCTGTATGCTGTTATGGGGTGG - Intronic
1111031763 13:82608926-82608948 ATCTGTATGCTTTTTATTGGGGG - Intergenic
1112186704 13:97134657-97134679 AGCATTATGCTTTCGATGGGAGG - Intergenic
1117345547 14:54828169-54828191 AGCTCTTTGCTATGCATGGGAGG + Intergenic
1117979190 14:61324996-61325018 AGCTGTAGGTTATGGATGAGAGG + Intronic
1137529425 16:49268491-49268513 AGCTGTATGCCAGTTATGGCTGG - Intergenic
1140819837 16:78652614-78652636 GGCTGTGTGCTAATGATGGCAGG - Intronic
1141257941 16:82420762-82420784 ATCTGCATGCTATAGATGAGAGG - Intergenic
1145794791 17:27649337-27649359 AGCTGTCTGCTCCTGGTGGGAGG + Exonic
1156137525 18:34060492-34060514 TACTGTATGTTATTAATGGGTGG + Intronic
1157858628 18:51122353-51122375 AACTATATGCGATTGAGGGGAGG + Intergenic
1159291585 18:66429909-66429931 ATCTGTGGGCTATTGATTGGAGG + Intergenic
1163043182 19:14617880-14617902 ACCTGTCTGCTATTGATGCTGGG - Intergenic
1163975135 19:20843668-20843690 ATGTGTATTCTATTGATGTGGGG - Intronic
927636548 2:24820977-24820999 GGCTGTATGCTATTGGAGGGTGG + Exonic
930768631 2:55110347-55110369 AGCTGCTTTCTATTGATGAGAGG - Intronic
931269630 2:60689949-60689971 TGCTGTATGCTATGGAGGGGAGG - Intergenic
939677620 2:145092194-145092216 AGGTGTATGCCATTTATGTGGGG - Intergenic
940182608 2:150952687-150952709 AGATGTATCCTGCTGATGGGTGG - Intergenic
941475744 2:165950463-165950485 AGGTGTATCCTAGTGATGGTGGG - Intronic
945982754 2:216327349-216327371 ATCTGTATGCTGGTGGTGGGGGG - Intronic
1169655282 20:7915852-7915874 AACTACATGCTAATGATGGGTGG + Intronic
1169895286 20:10498621-10498643 AACTGTATCATCTTGATGGGAGG + Intronic
1169923235 20:10757161-10757183 AGCTGTAGGCCATAGATAGGAGG + Intergenic
1178812252 21:35894993-35895015 AGCTGGATCCTACTAATGGGGGG + Intronic
1180818600 22:18809319-18809341 AGCAGTTTGACATTGATGGGTGG + Intergenic
1181204823 22:21243774-21243796 AGCAGTTTGACATTGATGGGTGG + Intergenic
1203222102 22_KI270731v1_random:51641-51663 AGCAGTTTGACATTGATGGGTGG - Intergenic
1203268729 22_KI270734v1_random:35172-35194 AGCAGTTTGACATTGATGGGTGG + Intergenic
954935738 3:54324919-54324941 AGCTCTTTGATATTGATGGAAGG + Intronic
957560839 3:81818632-81818654 AGCTGTTTCTTATTGATGGGTGG - Intergenic
957965111 3:87312312-87312334 AGTTGTATGTTACTGATGAGAGG - Intergenic
960064911 3:113361152-113361174 AGGTGTATGCTATTCATGGTGGG + Intronic
964364972 3:155940999-155941021 AGCTGTATGTAATTGATGATGGG - Exonic
970756427 4:19432132-19432154 AGCTGTCTGATATTAATTGGTGG - Intergenic
971139059 4:23903936-23903958 GGCTTTATGCTATTGGTAGGTGG - Intronic
972918354 4:43906669-43906691 AGCTGCTTGCTATTGACAGGGGG - Intergenic
986449705 5:7851830-7851852 AGCTGTATACTCGTGATTGGTGG + Intronic
989101712 5:37829469-37829491 AGCTGTAAACTATTGCTAGGTGG - Intronic
990275470 5:54191378-54191400 AGATGTATGCTGGTGATGGTGGG + Intronic
991648883 5:68830922-68830944 AGCCAAATGTTATTGATGGGAGG - Intergenic
997824705 5:137096167-137096189 AGCAGTATGCTATACTTGGGGGG - Intronic
998529862 5:142874604-142874626 AGCTGCATTCTATTAATGAGTGG + Intronic
998988163 5:147784895-147784917 AGCTGTTTTATGTTGATGGGAGG - Intergenic
999228182 5:150044914-150044936 AGCTGTGTGCTGATGATGTGTGG + Intronic
1001975305 5:175993918-175993940 ACATGTTTCCTATTGATGGGTGG + Intronic
1002242128 5:177849852-177849874 ACATGTTTCCTATTGATGGGTGG - Intergenic
1004485589 6:16063376-16063398 TCCTGTGTGCTATTGATGGTAGG + Intergenic
1006441907 6:34058397-34058419 TGCTGGATTCTATTGAAGGGAGG + Intronic
1006605152 6:35250844-35250866 TGATGAATGCTACTGATGGGAGG - Exonic
1006941996 6:37758467-37758489 AGCTGTATGGTTATGATGTGGGG + Intergenic
1007334586 6:41144627-41144649 TGCTGTATGCTTTTGATAGATGG + Intergenic
1007361981 6:41364636-41364658 AGCTGTGTAGTATTGATGGAGGG + Intergenic
1013910248 6:115267197-115267219 GGCTGTGTGGTATTGATGGAGGG + Intergenic
1017575713 6:155800636-155800658 AGCTGTATGCTATTTATAAGAGG + Intergenic
1023265791 7:38404009-38404031 AGCTGTCTGCTCTGGATTGGGGG + Intronic
1024898530 7:54289750-54289772 AGGTGTATGGTTTTGAAGGGAGG + Intergenic
1032338356 7:131047050-131047072 AGCTGTCTGCTACAGATGGTTGG + Intergenic
1036206610 8:6810154-6810176 AGCTGGATGCTATTTAGGGATGG - Exonic
1040812323 8:51468504-51468526 AGCTATATGCTATTTATAAGAGG - Intronic
1041227731 8:55716983-55717005 AACTGGGGGCTATTGATGGGGGG + Intronic
1044287202 8:90422744-90422766 AGCTGTATGCAATGGAAGGACGG + Intergenic
1047229536 8:122984738-122984760 AGGTGTATCCTATTGATAGCAGG - Intergenic
1047693089 8:127376658-127376680 AGATGGATGCTTCTGATGGGAGG + Intergenic
1049170826 8:141159626-141159648 ATCTGTGTGCTAGGGATGGGTGG - Intronic
1050170892 9:2815309-2815331 AGGTGTATGTTTTTGATGGTAGG - Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059030831 9:110693966-110693988 AGTTGTATGCTATAGATAGCAGG + Intronic
1061953312 9:133948553-133948575 AGCTGCTTGCTCTTGGTGGGGGG - Intronic
1189549225 X:42075935-42075957 AGCTGTATGCAGTTCATGTGTGG - Intergenic
1190370572 X:49736579-49736601 TGCTGATTGCTTTTGATGGGAGG - Intergenic
1192064028 X:67862308-67862330 ATCTGTCTAATATTGATGGGGGG + Intergenic
1194858318 X:98961898-98961920 AGCTTTTAGCTATTAATGGGAGG - Intergenic
1197367500 X:125582106-125582128 GATTGTATTCTATTGATGGGTGG + Intergenic
1197998087 X:132402082-132402104 TGTTGTATGCTATTCATGGCTGG - Intronic
1198940440 X:141949706-141949728 AAGTGTATGCCATTGTTGGGTGG + Intergenic