ID: 916160815

View in Genome Browser
Species Human (GRCh38)
Location 1:161911888-161911910
Sequence TCTAGCCCCCATCATTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916160815 Original CRISPR TCTAGCCCCCATCATTTTAC AGG Intronic
901150183 1:7096155-7096177 TCTAGACCCCCTCCTTCTACTGG - Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904705490 1:32387181-32387203 TCTAGATCACCTCATTTTACAGG - Intronic
910527711 1:88200161-88200183 AATAGACCCCATCATTTTAATGG + Intergenic
911567997 1:99487071-99487093 TCTGGCCCATATCATTTTTCTGG - Intergenic
913561978 1:120030582-120030604 TCTACTCCCCATCTTTTTATGGG - Intronic
913636147 1:120763011-120763033 TCTACTCCCCATCTTTTTATGGG + Intergenic
914282562 1:146189976-146189998 TCTACTCCCCATCTTTTTATGGG - Intronic
914409939 1:147417559-147417581 TCTTTCCCCCAACCTTTTACTGG + Intergenic
914543592 1:148640692-148640714 TCTACTCCCCATCTTTTTATGGG - Intronic
914623030 1:149430317-149430339 TCTACTCCCCATCTTTTTATGGG + Intergenic
916160815 1:161911888-161911910 TCTAGCCCCCATCATTTTACAGG + Intronic
919484438 1:198129675-198129697 GCTGGCCCCCTTCACTTTACAGG - Intergenic
923409362 1:233691738-233691760 TCTAGAGCCCATCACTTTGCAGG + Intergenic
1064847605 10:19672826-19672848 TCTGGCCTCCATCAATTTACTGG - Intronic
1071859079 10:89654450-89654472 TCTAGCCCCCACCCCTTTCCTGG - Intergenic
1071964621 10:90839696-90839718 TCTAGGAGCCATCATTTTGCAGG + Intronic
1074160266 10:110831039-110831061 TCTATCCCCCATCCTTTCCCAGG + Exonic
1075262946 10:120978705-120978727 TCTAACCCACATTCTTTTACTGG + Intergenic
1075662293 10:124206377-124206399 TCTTGCCCCCAAAAATTTACTGG + Intergenic
1079211761 11:18467355-18467377 TATAGCCTCCATCCTTTTATAGG + Intronic
1092550853 12:9498097-9498119 TCTACACCCTATCAATTTACTGG + Intergenic
1093538597 12:20253149-20253171 TCAAGTCCCCATCATTTTTTAGG - Intergenic
1094520964 12:31188276-31188298 TCTACACCCTATCAATTTACTGG - Intergenic
1097409666 12:59235695-59235717 TCCAGCCTCAATCATTTTACAGG + Intergenic
1099219423 12:79895162-79895184 GCTAGCCCTCTACATTTTACAGG - Intronic
1100904122 12:99278146-99278168 TCTAGCTCCCTTCATTTAAGTGG + Intronic
1105884395 13:24629434-24629456 CCTTGCCCCCTTGATTTTACTGG - Intergenic
1111649151 13:91067611-91067633 TCTAGCCCCCATCAGCTCCCTGG + Intergenic
1113084153 13:106550253-106550275 TCAAGGCCCCATCTTTTGACTGG + Intronic
1114747217 14:25162557-25162579 TCTAGCCCACATCAGCATACAGG - Intergenic
1124925656 15:34067856-34067878 TCTTCCCCACATCATTTTACTGG + Intergenic
1126508125 15:49431883-49431905 TCCAACCCCCAGCATTTTAGTGG - Intronic
1127034557 15:54900987-54901009 CCTTGCCCCCATCCTTTGACAGG - Intergenic
1130684701 15:86026542-86026564 TTTCTCCCCCATCATTTTCCTGG - Intergenic
1132104090 15:99050452-99050474 TCTAGCCCCCATTCTTTTGCTGG + Intergenic
1135744591 16:25005593-25005615 CCCAGCCCCTATCATTTGACAGG + Intronic
1136004320 16:27318310-27318332 TCTGGCCCCCAGGATTTTACAGG + Intronic
1145773902 17:27513293-27513315 TCTAGCCCGCAGCATTTTTTAGG - Intronic
1162652544 19:12101616-12101638 TCTCTCCCCCATAAATTTACAGG + Intronic
927814550 2:26203102-26203124 TCTAGCACACATCATTTTTTTGG + Intronic
928031613 2:27784436-27784458 TCTAGCACCCATCACTGTGCTGG - Intronic
928651154 2:33405057-33405079 TCTAGCCACACTGATTTTACTGG - Intergenic
929667306 2:43842968-43842990 TCTGGCCCCCATCATTGCAGGGG + Intronic
933986601 2:87596974-87596996 TCTTTGCCCCATCATTTCACAGG + Intergenic
936307236 2:111353827-111353849 TCTTTGCCCCATCATTTCACAGG - Intergenic
940622399 2:156128395-156128417 TCCAGCCCCCATATTTTTGCTGG + Intergenic
940748146 2:157594278-157594300 TCTTGACCTCCTCATTTTACAGG - Intronic
941279562 2:163533319-163533341 TATAGCCACCACCATTTTAAAGG + Intergenic
943487866 2:188510046-188510068 TCTAGCACCCCTCATCTTTCAGG - Intronic
944282743 2:197916745-197916767 TTTAGCCTACATCATTTTGCTGG - Intronic
947316432 2:228864255-228864277 TCTAGCACTCATCATTATAATGG + Intronic
947554626 2:231080595-231080617 TCTAGGCCCTAACATTTTACTGG + Intronic
1170891448 20:20379450-20379472 TTCAGCCCACATCATTTCACAGG - Intergenic
1172779692 20:37428885-37428907 TCAAGCCCCCATCATTCCTCTGG + Intergenic
1180974091 22:19836414-19836436 TCCAGCCCACATGACTTTACTGG + Intronic
1181744757 22:24948272-24948294 TCCAGACGCCCTCATTTTACAGG - Intergenic
1183420703 22:37709794-37709816 TCTAGCCCCCGCCCTTTTCCTGG + Intronic
1185384056 22:50523578-50523600 TCTGGGCCCCATCATTAAACGGG - Exonic
949293472 3:2493444-2493466 TCTGGCCTCCCTCATTTTACAGG + Intronic
949943106 3:9169935-9169957 CCCAGCCCCCTTCATTTTACAGG - Intronic
952445011 3:33372588-33372610 TCAAGACCCACTCATTTTACTGG - Intronic
956061352 3:65351210-65351232 TCTAGCCCCCACCATGTACCTGG + Intergenic
960446252 3:117752364-117752386 CTTAGGCCCCAACATTTTACTGG - Intergenic
974651665 4:64761731-64761753 TCTGGCCCAGATAATTTTACAGG - Intergenic
977297096 4:95222824-95222846 TCTTGCCCCCTTCATTTAATAGG + Intronic
979140257 4:117163204-117163226 TCCAGCCCCCATCACCTTCCTGG + Intergenic
982473537 4:155823124-155823146 TATACCCTCCATCATGTTACAGG + Intergenic
983795737 4:171860391-171860413 TCTAGGTCCTATTATTTTACTGG - Intronic
988167500 5:27613532-27613554 CCTTGCCCCCATCACTTGACAGG + Intergenic
988644653 5:33081019-33081041 TCTTTCCCCCTTCATTTTCCTGG - Intergenic
993630640 5:90282028-90282050 TCTGGCCTCCATCACTTCACTGG + Intergenic
999543381 5:152599042-152599064 TCTAGCCAGCAGCATTTTACAGG + Intergenic
1005374576 6:25169211-25169233 TTTGGCGCCCATGATTTTACTGG - Intergenic
1006861113 6:37171810-37171832 CCCCGCCCCCATCCTTTTACTGG - Intronic
1014192160 6:118508928-118508950 TCTAACCCTCACCATTTTATTGG + Intronic
1019221560 6:170477573-170477595 TCTACCACCTATCATTTTATAGG - Intergenic
1022635722 7:32132715-32132737 TCTTGCCCCCAACAATTTTCTGG - Intronic
1022664248 7:32395369-32395391 TCTTGCCCCCCTCATCTTTCTGG - Intergenic
1027744901 7:82061111-82061133 TCTAGCTCCCAACACTTTCCTGG + Intronic
1040379307 8:46856856-46856878 TTTAGCTCTCATCACTTTACTGG + Intergenic
1040615899 8:49038037-49038059 TCTAGCTGTCATCATTTTATGGG - Intergenic
1041697408 8:60750485-60750507 TGTAGCTCCCATCATATAACTGG - Intronic
1046500341 8:115068561-115068583 TCTATTTCCCATCATTTTAAAGG - Intergenic
1046567050 8:115915091-115915113 TCTAGGACACATCATTTTAAGGG + Intergenic
1046951143 8:120020761-120020783 TCTGGCCAGCATCATTTTAAAGG - Intronic
1050568806 9:6916106-6916128 TCTAGCCCCCATCTTTACTCAGG - Intronic
1051358854 9:16264381-16264403 TCCAGCCACCATCACTTTGCCGG + Intronic
1053005487 9:34601386-34601408 TCTGGCCCCCATCACTGTACTGG - Intergenic
1055429124 9:76226353-76226375 TCTTTCCCCCATCGCTTTACTGG - Intronic
1056711946 9:88998534-88998556 TTTAGCACCCATCAGTGTACAGG + Exonic
1059583714 9:115582052-115582074 TCTAGCACCTGTCATATTACTGG - Intergenic
1059656243 9:116360227-116360249 TCTAGGCCCCATGATTCTCCTGG - Intronic
1061669500 9:132180615-132180637 TGCAGACCCCCTCATTTTACAGG - Intronic
1187498920 X:19822009-19822031 TCTGGACTCCATTATTTTACAGG + Intronic
1191756164 X:64594688-64594710 TCTATCTCCCTTCATTGTACAGG + Intergenic