ID: 916161032

View in Genome Browser
Species Human (GRCh38)
Location 1:161914995-161915017
Sequence GTGAATTTACTAGTAATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916161032 Original CRISPR GTGAATTTACTAGTAATGAC TGG (reversed) Intronic
906081238 1:43089883-43089905 GTGATTTGACTAGTAAAGGCCGG - Intergenic
906872086 1:49494134-49494156 GTGAATTTAATTGTTAAGACTGG - Intronic
907504821 1:54910469-54910491 GTGATTTGACTAGTAAAGGCTGG + Intergenic
909787747 1:79637848-79637870 GTGAATTAAATAGTACTGAGTGG + Intergenic
910256632 1:85254846-85254868 GTTAATTTACTTGTAATAAGTGG - Intronic
910843505 1:91584036-91584058 TTGAATTTCCCAGTAGTGACTGG - Intergenic
916161032 1:161914995-161915017 GTGAATTTACTAGTAATGACTGG - Intronic
916989995 1:170232704-170232726 GTGAATTTGCTAGAAAGGAAAGG - Intergenic
919430052 1:197481295-197481317 GTGAGTTTACAAGGAGTGACAGG + Intergenic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
922642757 1:227250878-227250900 GTAAATTTTCTTGTAGTGACGGG - Intronic
923075546 1:230605805-230605827 GTGATTTGACTAGTAAAGGCTGG - Intergenic
924757774 1:246957207-246957229 TTGTATTTATTAGTAAAGACGGG - Intronic
1071422527 10:85514903-85514925 GTAAATTTATTAGAATTGACGGG - Intergenic
1072741265 10:97911383-97911405 GGCAATTTTCTAGTAATTACAGG - Intronic
1073878853 10:107956219-107956241 GTGTATTTACTTGAAATGTCTGG - Intergenic
1074664101 10:115698362-115698384 GAGAATTTACAAATAAGGACAGG + Intronic
1079841950 11:25414516-25414538 TTGAATTTATTAGTAGAGACGGG - Intergenic
1080203865 11:29706671-29706693 GTGATTTGACTAGTAAAGGCCGG + Intergenic
1081349582 11:42034098-42034120 GTGATTTTTCTAGTATTGATAGG + Intergenic
1081744504 11:45463419-45463441 TTGAATTTACAAATAAAGACAGG - Intergenic
1083229453 11:61306620-61306642 GTGCAGTTACTTGTAATGCCAGG - Intronic
1084354632 11:68629541-68629563 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1086216552 11:84389294-84389316 GTGAAATTACTAGTGATCAAGGG + Intronic
1087793953 11:102435971-102435993 GTGAATATACTAAAAATCACTGG + Intronic
1088639891 11:111862107-111862129 GAGAATTTTCTAGAAATGATGGG - Intronic
1089953765 11:122552293-122552315 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1091818998 12:3460341-3460363 CAGAATTTCCTAGGAATGACAGG - Intronic
1092851007 12:12626614-12626636 GTGAATATACTAAGAATCACAGG - Intronic
1093358890 12:18200365-18200387 GTGATTTGACTAGTAAAGACTGG - Intronic
1093567074 12:20619933-20619955 CCGAATTTACTAGTAATTAATGG + Intronic
1093601030 12:21023194-21023216 GTGAATGTAATGGGAATGACTGG + Exonic
1094826183 12:34270898-34270920 GTGATTTAACTAGTAAAGGCTGG - Intergenic
1094834365 12:34315385-34315407 GTGTATTTACCAGTGATGCCAGG + Intergenic
1096341047 12:50799620-50799642 GTGAATTTTCTTGAAATGAAAGG + Intronic
1096883535 12:54693668-54693690 ATGAATTTGCTATAAATGACTGG - Intergenic
1097606292 12:61758649-61758671 GTGAATTTACCAGGAAAGAGTGG + Intronic
1098187101 12:67908855-67908877 GGTAATTTGCTAGTAATTACAGG - Intergenic
1099462970 12:82946913-82946935 GTGTATTTTTTAGTAAAGACGGG + Intronic
1102116341 12:110406040-110406062 GTGATTTGACTAGTAAAGGCCGG + Intergenic
1103198060 12:119063276-119063298 GTGCATTTATTAGTAAGGATAGG + Intronic
1103471764 12:121187582-121187604 GTGAAATTACAAATAATCACTGG + Exonic
1105360110 13:19704460-19704482 GTGGATTTACAACTGATGACAGG + Intronic
1106754956 13:32813454-32813476 GTGGATTTATTAGTAAAGCCAGG - Intergenic
1112237184 13:97646916-97646938 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1115054122 14:29101534-29101556 GTGAAATGACCAGCAATGACAGG - Intergenic
1117801497 14:59448488-59448510 GTGATTTGACTAGTAAAGGCTGG - Intronic
1118408864 14:65455500-65455522 GTGAATTTGCATGTTATGACTGG + Intronic
1120479001 14:85024803-85024825 GTAAAATTATTAGTAGTGACAGG + Intergenic
1120618562 14:86735764-86735786 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1121389568 14:93562661-93562683 GTGATTTGACTAGTAAAGGCCGG + Intronic
1124201849 15:27685452-27685474 ATGAATTTACTAGAGCTGACTGG - Intergenic
1125212895 15:37237494-37237516 GTGATTTGACTAGTAAAGGCTGG + Intergenic
1125959749 15:43819702-43819724 GTGTATTTTTTAGTAAAGACAGG + Intronic
1128899902 15:71410858-71410880 GTGTATTTTTTAGTAGTGACAGG - Intronic
1129481297 15:75828539-75828561 GTAAGTTTGATAGTAATGACAGG + Intergenic
1129628530 15:77232235-77232257 GGCATTTTACTAGTAAAGACAGG - Intronic
1130820354 15:87488636-87488658 GGGAACGTACTAGAAATGACAGG - Intergenic
1133765401 16:8834332-8834354 GTGATTTGACTAGTAAAGGCTGG + Intronic
1133766407 16:8841229-8841251 GTGATTTGACTAGTAAAGGCTGG + Intronic
1134156352 16:11846672-11846694 GTAAGTTTCTTAGTAATGACTGG - Intronic
1136362872 16:29792423-29792445 GTGAATAAACTACTAATCACTGG - Intronic
1138758680 16:59518254-59518276 GTGATTTGACTAGTAAAGGCTGG + Intergenic
1139724149 16:68882538-68882560 GTGAATTTAGTAGGTAGGACAGG + Intronic
1154239145 18:12636187-12636209 TTAAATTTTCTAGTACTGACTGG - Intronic
1154354941 18:13617569-13617591 GTGAAGTTTCAAGAAATGACTGG + Intronic
1155852804 18:30793582-30793604 TTTAATTTGCCAGTAATGACTGG + Intergenic
1156923716 18:42553663-42553685 GTGATTTGACTAGTAAAGGCTGG + Intergenic
1165029462 19:32987179-32987201 GTGAATATACTAAAAATCACTGG - Intronic
925477123 2:4229964-4229986 GTGAAGTTACTAGTACTGTATGG + Intergenic
929004503 2:37382267-37382289 GTGATTTGACTAGTAAAGGCTGG + Intergenic
930706290 2:54508147-54508169 GTGATTTGACTAGTAAAGGCCGG + Intronic
931476843 2:62596648-62596670 GTGAACTAGCTGGTAATGACGGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932170188 2:69548186-69548208 GTGAATATACTAAAAATCACTGG + Intronic
935594989 2:104871458-104871480 ATGACTTTATTACTAATGACTGG - Intergenic
935785342 2:106543781-106543803 GTGAAATTACTCTTATTGACTGG + Intergenic
939533005 2:143389212-143389234 GTGAATTTACTATTAAGCCCAGG + Intronic
940508424 2:154584214-154584236 GTGATTTGACTAGTAAAGGCCGG + Intergenic
941499387 2:166250937-166250959 ATGAAGTTACTAATAAAGACTGG + Intronic
944107814 2:196098348-196098370 GAGAAATTCCTAGTAATTACAGG - Intergenic
946072364 2:217045440-217045462 TTCAATTTAGTAGTAATTACTGG - Intergenic
947842390 2:233216394-233216416 GTGATTTGACTAGTAAAGGCCGG + Intronic
1169999521 20:11598876-11598898 GTAAAATTAGTAGTAATGTCGGG - Intergenic
1178018605 21:28381763-28381785 GTTCATTGCCTAGTAATGACAGG - Intergenic
1178518826 21:33270212-33270234 GTGCATTTTCTAGTACTGATTGG + Intronic
1183078950 22:35444141-35444163 CTGAATTTATTAGAACTGACAGG + Intergenic
949671487 3:6402088-6402110 GTGATTTGACTAGTAAAGGCTGG - Intergenic
950875356 3:16266430-16266452 GTGTATTTTTTAGTAAAGACGGG - Intronic
951762360 3:26160931-26160953 GTGATTTGACTAGTAAAGGCCGG + Intergenic
951895017 3:27602098-27602120 GTGATTTGACTAGTAAAGGCCGG - Intergenic
952923445 3:38304561-38304583 TTGAATTTTCTTGTAAAGACAGG + Intronic
953599091 3:44346253-44346275 GTGATTTGACTAGTAAAGGCTGG + Intronic
957533337 3:81468542-81468564 GTCACTTAACTAGCAATGACTGG - Intergenic
959803011 3:110517745-110517767 GTGCATTTACTACTAGTGATGGG - Intergenic
964940527 3:162154680-162154702 GTGATTTGACTAGTAAAGGCTGG + Intergenic
964979577 3:162663117-162663139 GTGCATTTATTAGGAATGAGAGG + Intergenic
965372870 3:167886275-167886297 GTGATTTTTCTGGTAATGACAGG + Intergenic
965861564 3:173156503-173156525 GTGATTTGACTAGTAAAGGCCGG + Intergenic
966067259 3:175832918-175832940 GTGATTTGACTAGTAAAGGCTGG - Intergenic
967004921 3:185375087-185375109 GTGATTTGACTAGTAAAGGCTGG + Intronic
974352395 4:60766260-60766282 GTGAAATTACCAGTAACAACAGG + Intergenic
974778454 4:66519935-66519957 CTGAATTTTCTAGTGAAGACTGG - Intergenic
978284198 4:107055753-107055775 TTGAATTTTTTAGTAAGGACGGG - Intronic
981565082 4:146092400-146092422 GTGATTTTATTAGCAATGATGGG + Intergenic
984035786 4:174665830-174665852 GTGTATTGACTTGTAATCACTGG + Intronic
986368528 5:7058685-7058707 GTGATTTCACTAGTAAAGGCTGG + Intergenic
988182842 5:27819638-27819660 GTGTATTTATTAGAAATGAGTGG + Intergenic
989801540 5:45547893-45547915 GTGTATTTACTAGTAAATATTGG - Intronic
992005191 5:72470626-72470648 GTAAATTTCCAAGTAATGATTGG - Intronic
992732456 5:79686922-79686944 GTTAATATTCTAGTGATGACTGG + Intergenic
994386248 5:99136503-99136525 GTGAGATTACTAGTAAAGTCTGG + Intergenic
994851840 5:105065386-105065408 GTAATTTTAATAGCAATGACAGG - Intergenic
995823377 5:116264445-116264467 GTGAATGTAACAGTAATGTCAGG - Intronic
996106685 5:119512925-119512947 ATGAATATACTAAAAATGACTGG + Intronic
997635590 5:135402315-135402337 GTGATTTTCCTAGAAATGACAGG + Intergenic
998693372 5:144612618-144612640 GTGATTTGACTAGTAAAGGCTGG + Intergenic
1000165124 5:158640833-158640855 GTGAATGTCCAAGAAATGACAGG - Intergenic
1000601698 5:163283136-163283158 ATGAATGTACTAGAAATAACTGG + Intergenic
1007559932 6:42798848-42798870 GTAAATATTCTAGAAATGACTGG - Intronic
1009343650 6:62588469-62588491 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1012284433 6:97371684-97371706 GTGAATTTACTACTAATTCCAGG - Intergenic
1013614010 6:111824652-111824674 GTGAAATTCAGAGTAATGACTGG - Intronic
1013895222 6:115080319-115080341 GTGAAGTTAATAATAATTACAGG + Intergenic
1014158658 6:118141012-118141034 GTTAATTTACTATTAAAGAAAGG + Intronic
1014995854 6:128143537-128143559 GTGCAATTATTGGTAATGACTGG - Intronic
1015370175 6:132441437-132441459 GTGACATTACCAGTAATGAGTGG + Intergenic
1016204879 6:141457435-141457457 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1022373189 7:29789241-29789263 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1023678992 7:42664278-42664300 GTGAATTCACTAATTATGAAAGG + Intergenic
1024738829 7:52334234-52334256 GTGATTTGACTAATAATGGCTGG + Intergenic
1027770908 7:82404691-82404713 GTAAAATTAATAGTATTGACTGG - Intronic
1028076845 7:86527010-86527032 GTGACTTTACTATTAAAAACAGG - Intergenic
1028090154 7:86690437-86690459 GTGAATTTACAAGAAATAAGAGG + Intronic
1028424656 7:90673031-90673053 GTAAATTTACTAGTAAGGAGTGG + Intronic
1030045021 7:105487138-105487160 GTGAATATACTAAAAATCACTGG - Intronic
1031777770 7:125922811-125922833 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1031838150 7:126703940-126703962 GTGAATTTGCAGGTAAGGACAGG - Intronic
1033464611 7:141579360-141579382 GTGATTTGACTAGTAAAGGCCGG + Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1037691930 8:21188849-21188871 GTAAAGTTATTAGTAATCACTGG - Intergenic
1038554778 8:28501351-28501373 GTGCATTAACTATCAATGACTGG - Intronic
1039946399 8:42132874-42132896 GTAAATTTCCTAGTACTGAAGGG - Intergenic
1040923717 8:52653282-52653304 ATGAATTTAATGGGAATGACAGG + Intronic
1042339146 8:67660791-67660813 GTGAATTTTCTGGAAAGGACAGG + Intronic
1043599289 8:81918626-81918648 GTGATTTGACTAGTAAAGGCCGG - Intergenic
1044262830 8:90147863-90147885 TTGTAATTACTAATAATGACTGG - Intergenic
1046294447 8:112200232-112200254 GTGATTTGACTAGTAAAGGCCGG - Intergenic
1049078778 8:140424074-140424096 GTAAATATACTAAAAATGACTGG + Intronic
1050389931 9:5131609-5131631 TTGTATTTACTAGTAGAGACAGG + Intergenic
1050636193 9:7615764-7615786 GGGAATTTATTAGTATTGACTGG + Intergenic
1050639213 9:7648353-7648375 GTGAATTTAGTAGCAGTTACTGG + Intergenic
1051289956 9:15534933-15534955 GTTAAATTACTAGTAATCAAGGG - Intergenic
1051671332 9:19513759-19513781 GTGAATTTTATATTATTGACTGG - Exonic
1052653740 9:31331356-31331378 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1053243762 9:36517945-36517967 GTGTTTTTATTAGTAGTGACGGG + Intergenic
1055680828 9:78713365-78713387 ATGCATTTACTAGTAATGTGAGG - Intergenic
1056324283 9:85463612-85463634 GTGATTTGGCTAGTAAAGACTGG - Intergenic
1056594715 9:87997551-87997573 TTGTATTTTCTAGTAAAGACAGG - Intergenic
1058266817 9:102910452-102910474 ATGAATTTATTAGTTCTGACAGG + Intergenic
1186007039 X:5084293-5084315 GGGAAATTCCTGGTAATGACGGG - Intergenic
1186166321 X:6830040-6830062 GTGTATTTTCTGGTACTGACAGG - Intergenic
1186270935 X:7887230-7887252 ATGAATTTACTAGGAAGCACTGG + Intergenic
1191660456 X:63644196-63644218 GTGAAATTCCTAGAAATTACTGG - Intronic
1191761737 X:64654303-64654325 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1192426280 X:71079772-71079794 GTGAATTTTATAGTAGTGTCAGG - Intergenic
1194427696 X:93760246-93760268 GCGAATTTTCCAGTCATGACTGG + Intergenic
1195326452 X:103762416-103762438 GTGATTTAACTAGTAAAGGCCGG + Intergenic
1197500145 X:127231748-127231770 GTGATTTGACTAGTAAAGGCCGG - Intergenic
1199073390 X:143503828-143503850 GTGATTTGACTAGTAAAGGCCGG + Intergenic
1199763189 X:150921362-150921384 GTGAATGTACTAGAAACCACAGG + Intergenic
1201354462 Y:13082720-13082742 GTGTATTTACTAGCCATGATGGG - Intergenic
1201937549 Y:19424371-19424393 GTGATTTGACTAGTAAAGGCTGG - Intergenic
1202076103 Y:21039397-21039419 ATGATTTGACTAGTAAAGACTGG + Intergenic