ID: 916163839

View in Genome Browser
Species Human (GRCh38)
Location 1:161946529-161946551
Sequence TGAGTTCCATAGTTACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916163837_916163839 3 Left 916163837 1:161946503-161946525 CCTTGCTAAAAAATCTCTTTATG 0: 1
1: 0
2: 1
3: 14
4: 309
Right 916163839 1:161946529-161946551 TGAGTTCCATAGTTACAACCAGG 0: 1
1: 0
2: 1
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916163839 Original CRISPR TGAGTTCCATAGTTACAACC AGG Intronic
911657048 1:100456123-100456145 TTAGTTCCATTGTGACAACTAGG + Intronic
913107712 1:115629708-115629730 CTGGTTCCAGAGTTACAACCAGG + Intergenic
916163839 1:161946529-161946551 TGAGTTCCATAGTTACAACCAGG + Intronic
924584655 1:245351302-245351324 TGAGCTCCCTAGTTGCAAACTGG + Intronic
1067784518 10:49234812-49234834 TGAGTCCAATGGTTACAACCAGG - Intergenic
1069953804 10:72037361-72037383 TGAGTGCCAGTGGTACAACCTGG - Intergenic
1075373187 10:121954959-121954981 TAAGTTCAATAGTTACAAAAAGG + Intergenic
1081631150 11:44690885-44690907 TGAGTGACACAGCTACAACCTGG + Intergenic
1082923826 11:58524607-58524629 TTATTTCCAAAGTTACAAGCAGG - Intergenic
1091615690 12:2049869-2049891 TGTGTTCCAAAGTTAAAAGCTGG + Intronic
1095512003 12:42961416-42961438 TGAGTCTCATAGATAAAACCTGG + Intergenic
1096043610 12:48542545-48542567 TTAGTCTCATAGTTACAACCCGG - Intergenic
1096446821 12:51700419-51700441 TGAGTTCCATAGATACATTCTGG - Intronic
1105751787 13:23427576-23427598 TGAGTTACACAGTTTCAAACAGG + Intronic
1109921316 13:69063735-69063757 TAAGTTCTATAATTTCAACCAGG + Intergenic
1115784976 14:36815375-36815397 TGAATTCCAAATTTACAATCAGG - Intronic
1117394421 14:55294696-55294718 TGTGTTCCATAATTACACCGGGG + Intronic
1124859714 15:33427092-33427114 TGGGTTCTATAGTTACCAGCTGG + Intronic
1129950921 15:79590508-79590530 GGAGTTCCATGATTATAACCTGG + Intergenic
1130371172 15:83285787-83285809 TGCCTTCCATAGCCACAACCAGG - Intergenic
1139590882 16:67932144-67932166 TTAGGTCTATAGTGACAACCTGG + Exonic
1143174015 17:4946296-4946318 TGAGTTCTTTTGTTAGAACCTGG - Intronic
1146425007 17:32729734-32729756 TGGGTACCAAAGTTAGAACCTGG + Intronic
1148401544 17:47366637-47366659 TGATTGCCTTAGTTTCAACCAGG + Intronic
1155866527 18:30972778-30972800 TGGGTTCAATAGTTACCAGCTGG - Intergenic
1157707064 18:49815816-49815838 TGAGATCCTTAATTAAAACCTGG + Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1165275735 19:34749617-34749639 TGATTTCCAGAGTTACCACATGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167520574 19:49952099-49952121 TGACTTCCATAGTGAGAACTGGG + Intronic
936913998 2:117621014-117621036 TGGGTTCCTAAGTTAGAACCAGG - Intergenic
945384165 2:209177306-209177328 TGGGTACTATAGTTACCACCTGG - Intergenic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1178934968 21:36853344-36853366 TTCCTTCCATAGTTACACCCAGG - Intronic
950048934 3:9971216-9971238 TGTGTTCCATACTTACAAGAAGG + Intronic
950294729 3:11819058-11819080 AGAGTTAGATAGTTAAAACCTGG + Intronic
950969732 3:17174286-17174308 TGAGCACCATATTTAGAACCTGG - Intronic
953938006 3:47063265-47063287 TGACTTCCAAAGTTATCACCTGG - Intronic
956426971 3:69145869-69145891 TGACTTCCATGGTGACAATCTGG - Intergenic
957236149 3:77594477-77594499 TAAGTTCCATAGTTACATGGAGG + Intronic
961905689 3:130260709-130260731 TTAGTTCCCTAGTTCTAACCTGG - Intergenic
961951817 3:130757460-130757482 ACAGTTACAAAGTTACAACCTGG + Intergenic
964365289 3:155944233-155944255 TGAATTCCATAGTTACTTTCAGG + Intergenic
965319685 3:167237508-167237530 TCAGTTCCATAGTTAGAACCAGG + Intergenic
967783549 3:193465837-193465859 TAAGTTCCATAATAACAAACAGG - Intronic
969488817 4:7487114-7487136 TGAGTCACATCGTTACCACCCGG - Intronic
970692955 4:18641143-18641165 TGAGCTCCATGCTTATAACCTGG + Intergenic
975914010 4:79300990-79301012 TGAGTTCCAGAGTCACACACAGG + Intronic
976912125 4:90320512-90320534 TGAGTACGATAGTTATAAACTGG + Intronic
984447596 4:179856551-179856573 TGAGTTCCAGATTTAAAACTGGG + Intergenic
985082759 4:186283310-186283332 TGTGTTCCATGGCTCCAACCGGG + Intronic
1008040228 6:46789698-46789720 AGAGTTACATAGCTACAACAGGG + Intergenic
1009542808 6:64985109-64985131 TCAGTTCAATTGCTACAACCAGG - Intronic
1010442758 6:75917199-75917221 TGATTTCCACAGTTTTAACCTGG - Intronic
1014582488 6:123156178-123156200 GGAGTTTTATAGTTAAAACCTGG - Intergenic
1015653004 6:135483866-135483888 TTACTTCCATAATTATAACCAGG + Intronic
1029884845 7:103857650-103857672 TGAGCTCCATAGCTCCCACCTGG - Intronic
1034878541 7:154746205-154746227 TGAGTTCCAAAGACACAACCTGG + Intronic
1041690581 8:60682108-60682130 TGACTTCCATATTTTCAACTTGG - Intronic
1042847733 8:73185313-73185335 TGAGTCACATAGTCACAGCCCGG + Intergenic
1044089971 8:87988474-87988496 AGAGTTCCATGGTTAGAATCTGG + Intergenic
1048176730 8:132159481-132159503 TGAGTTACATATTCACACCCTGG - Intronic
1057514138 9:95706751-95706773 TGAGTTCCATAGTTGCAATATGG + Intergenic
1057632215 9:96729119-96729141 TGAATTCCACAGTCACATCCTGG - Intergenic
1058758873 9:108110209-108110231 TGGGTTCCATGGTTATAACATGG - Intergenic
1188813171 X:34678356-34678378 TGACTTCCATTCTGACAACCAGG + Intergenic
1189084717 X:38009982-38010004 TGATTTCAATAGTTAAGACCTGG - Intronic
1191139808 X:57105025-57105047 TGATTTCCTTTGTTACAACAAGG - Intergenic
1192929936 X:75795767-75795789 TGATTTACATATTTTCAACCAGG + Intergenic
1193187184 X:78527404-78527426 TGAGATCCTTAGATACAATCAGG + Intergenic
1194384115 X:93232177-93232199 TGAGTTCAAGAGTGAGAACCAGG + Intergenic
1196129048 X:112132834-112132856 TAAGTTCCATACTTCCAACATGG + Intergenic
1196708480 X:118738317-118738339 TGGGTACCATGGTTACAGCCTGG - Intronic
1198601903 X:138293315-138293337 TGAATTCCTAAGTTACAAGCTGG + Intergenic