ID: 916167534

View in Genome Browser
Species Human (GRCh38)
Location 1:161977294-161977316
Sequence AGAACTCCCCCTTTTTGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916167534_916167539 24 Left 916167534 1:161977294-161977316 CCCTAGCAAAAAGGGGGAGTTCT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data
916167534_916167536 3 Left 916167534 1:161977294-161977316 CCCTAGCAAAAAGGGGGAGTTCT No data
Right 916167536 1:161977320-161977342 AAGAACCCACAAAAGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916167534 Original CRISPR AGAACTCCCCCTTTTTGCTA GGG (reversed) Intergenic
No off target data available for this crispr