ID: 916167535

View in Genome Browser
Species Human (GRCh38)
Location 1:161977295-161977317
Sequence AAGAACTCCCCCTTTTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916167535_916167539 23 Left 916167535 1:161977295-161977317 CCTAGCAAAAAGGGGGAGTTCTT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data
916167535_916167536 2 Left 916167535 1:161977295-161977317 CCTAGCAAAAAGGGGGAGTTCTT No data
Right 916167536 1:161977320-161977342 AAGAACCCACAAAAGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916167535 Original CRISPR AAGAACTCCCCCTTTTTGCT AGG (reversed) Intergenic
No off target data available for this crispr