ID: 916167537

View in Genome Browser
Species Human (GRCh38)
Location 1:161977325-161977347
Sequence AGTCTCCTGAGCACTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916167537_916167539 -7 Left 916167537 1:161977325-161977347 CCCACAAAAGTGCTCAGGAGACT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916167537 Original CRISPR AGTCTCCTGAGCACTTTTGT GGG (reversed) Intergenic
No off target data available for this crispr