ID: 916167539

View in Genome Browser
Species Human (GRCh38)
Location 1:161977341-161977363
Sequence GGAGACTTTAAGCACCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916167535_916167539 23 Left 916167535 1:161977295-161977317 CCTAGCAAAAAGGGGGAGTTCTT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data
916167538_916167539 -8 Left 916167538 1:161977326-161977348 CCACAAAAGTGCTCAGGAGACTT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data
916167534_916167539 24 Left 916167534 1:161977294-161977316 CCCTAGCAAAAAGGGGGAGTTCT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data
916167537_916167539 -7 Left 916167537 1:161977325-161977347 CCCACAAAAGTGCTCAGGAGACT No data
Right 916167539 1:161977341-161977363 GGAGACTTTAAGCACCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916167539 Original CRISPR GGAGACTTTAAGCACCTCTC AGG Intergenic
No off target data available for this crispr