ID: 916168144

View in Genome Browser
Species Human (GRCh38)
Location 1:161981445-161981467
Sequence GAGCAGAAACGGAAGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 435}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916168144_916168148 -3 Left 916168144 1:161981445-161981467 CCCTCTGCCTTCCGTTTCTGCTC 0: 1
1: 0
2: 5
3: 38
4: 435
Right 916168148 1:161981465-161981487 CTCCATATCCCCTGATCAGATGG 0: 1
1: 0
2: 0
3: 13
4: 119
916168144_916168152 6 Left 916168144 1:161981445-161981467 CCCTCTGCCTTCCGTTTCTGCTC 0: 1
1: 0
2: 5
3: 38
4: 435
Right 916168152 1:161981474-161981496 CCCTGATCAGATGGCTTTCTCGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916168144 Original CRISPR GAGCAGAAACGGAAGGCAGA GGG (reversed) Intergenic
901137169 1:7005459-7005481 AAGAAGAAAAAGAAGGCAGAAGG - Intronic
901247400 1:7743470-7743492 GGGCAGAGACGGACTGCAGATGG - Intronic
901497880 1:9632484-9632506 CAGCAGAAACAGAGGGCAGCTGG - Intergenic
902846347 1:19113555-19113577 TAGCTGAAAAGGCAGGCAGATGG - Intronic
905162789 1:36051375-36051397 GAGCAAAAACAGAATTCAGAGGG + Intronic
905329208 1:37180328-37180350 CAGCAGACTGGGAAGGCAGAGGG - Intergenic
905894055 1:41533908-41533930 GAGCAGACACTGCAGGTAGAGGG - Intronic
906119834 1:43382065-43382087 GAGCAGATAGGAAAGGCAGATGG + Intergenic
906214523 1:44031027-44031049 GAGCTGAAGCGGGAGGGAGAGGG - Intronic
907917419 1:58883663-58883685 GAGCAGAACCGGAACACTGAAGG + Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908642724 1:66243229-66243251 CAGCAGAAACACAAGGCAGTGGG + Intronic
908784624 1:67722710-67722732 GAGCAGAAAAAGCAGGCATAAGG + Intronic
908794507 1:67817688-67817710 GGGAAGAAAGGGAAGGCAGCAGG + Intronic
909065911 1:70935355-70935377 GAGAAGAAAGAGTAGGCAGAAGG - Intronic
910268248 1:85364248-85364270 GTACAGAATTGGAAGGCAGAAGG - Intronic
910380416 1:86621253-86621275 GAGCAGAAGCTCAAAGCAGAGGG + Intergenic
911824842 1:102469372-102469394 GAGCAGAAGAGGAAGGCAGATGG + Intergenic
913041966 1:115035868-115035890 AGGCAGAAACGGCAGGTAGAAGG - Intergenic
913338459 1:117733066-117733088 GAGCCCAAAGGGAAGCCAGAGGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
913646770 1:120863950-120863972 GAGAAGCAAGGGAAGGCAGGCGG - Intergenic
914079877 1:144398920-144398942 GAGAAGCAAGGGAAGGCAGGCGG + Intergenic
914174781 1:145267455-145267477 GAGAAGCAAGGGAAGGCAGGCGG + Intergenic
914529508 1:148508939-148508961 GAGAAGCAAGGGAAGGCAGGCGG + Intergenic
915452206 1:156013887-156013909 CAGATGAAAAGGAAGGCAGAAGG + Intronic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916530591 1:165652761-165652783 GGGCAGCAACAGAGGGCAGAGGG + Intronic
917063732 1:171068907-171068929 GAGTAGAATAGGAAGGCACATGG + Intergenic
918236820 1:182589150-182589172 GAGCAGGTAAGGCAGGCAGAAGG - Exonic
918794845 1:188880547-188880569 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
919757197 1:201073568-201073590 GAGCAGAAACCCAAGGGTGAGGG - Exonic
920922225 1:210307521-210307543 GAGTAGAAACAGAAGGGAGGAGG - Intergenic
921249547 1:213283568-213283590 GAGCAGCAACTGAAGGTGGAAGG + Intergenic
921302204 1:213762052-213762074 GAGGAGAAAAGGAAGAAAGAGGG + Intergenic
921608480 1:217182573-217182595 GAGCAAAAATGGAAGAGAGAAGG + Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922313504 1:224419555-224419577 AAGCAGAATGGGAAGGCAAAGGG - Exonic
922580697 1:226695729-226695751 CAGCAGAATTGGAAGACAGATGG + Intronic
922868157 1:228878326-228878348 GACGAGAAAGGGAAGGCAGGAGG - Intergenic
922893440 1:229079975-229079997 AATCAGAATCGCAAGGCAGATGG - Intergenic
923093820 1:230759332-230759354 GAGCAGGCAAGGGAGGCAGAAGG + Intronic
923159816 1:231306360-231306382 GAGTAGGAAAGTAAGGCAGAAGG - Intergenic
923926158 1:238629586-238629608 GAGCAGACTCTGAAGGCACAAGG - Intergenic
923935800 1:238758854-238758876 GAGTAGAAAAGGAGGGCAAATGG + Intergenic
923976747 1:239272509-239272531 GACCATAAACGTAAGCCAGAGGG + Intergenic
924940810 1:248811589-248811611 GAGCAGAAAGGGAAAGCAAAGGG + Exonic
1062988138 10:1789305-1789327 GAACAGAAAATAAAGGCAGAAGG - Intergenic
1063685990 10:8237623-8237645 TGGCAGATAGGGAAGGCAGAGGG - Intergenic
1065251921 10:23823947-23823969 GAACTGAAAAGAAAGGCAGAGGG + Intronic
1065746075 10:28843614-28843636 GGGCAGAAATGGAAGAGAGAAGG - Intergenic
1065903523 10:30228628-30228650 GTGCAGAAATGGAGGGCAAATGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067536183 10:47111897-47111919 GAGAAGAAAAGGCAGGCTGAGGG + Intergenic
1068120531 10:52779134-52779156 GAGCAGCAAAGGAAGGCAGAGGG + Intergenic
1069675449 10:70243532-70243554 GAGCTGAACACGAAGGCAGATGG - Intergenic
1069901258 10:71707942-71707964 GGGAAGAAAGGGAAGGCTGAGGG - Intronic
1071048264 10:81412037-81412059 AGGCAGAAATGGAAGACAGAAGG + Intergenic
1071353213 10:84767417-84767439 CAGCAGATGCGGAAGCCAGAAGG + Intergenic
1071795382 10:88999231-88999253 AAGAAGTAACAGAAGGCAGAGGG - Intronic
1074676703 10:115859480-115859502 GCCCAGAAAAGGCAGGCAGAAGG + Intronic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075488786 10:122848455-122848477 GAGCTGGAACAGAAGGCAGCTGG + Intronic
1075646495 10:124100220-124100242 TGGCAGAAAAGGAGGGCAGAGGG - Intergenic
1076136476 10:128048689-128048711 TAGCAGGAACGGAAGGGAGGAGG + Intronic
1078189175 11:9077366-9077388 AAATAGAAACTGAAGGCAGATGG + Intronic
1079105380 11:17568865-17568887 GAGCAGAGATGGAACCCAGATGG - Intronic
1079443291 11:20536312-20536334 GAACTGAAACTGGAGGCAGAAGG + Intergenic
1079639717 11:22790021-22790043 GAGGAGAAAAGGGAGACAGAAGG - Intronic
1079897698 11:26142934-26142956 GAACAGAAACAGAAGGGAAATGG + Intergenic
1079999473 11:27331345-27331367 GAGTATAAAGGTAAGGCAGAAGG - Intronic
1080614339 11:33932961-33932983 GAGAGGAAATGGAGGGCAGAGGG - Intergenic
1080628829 11:34053522-34053544 GAGCACAAAGCGAAAGCAGAGGG + Intronic
1082722803 11:56699060-56699082 TACCAGAAACTGATGGCAGATGG + Intergenic
1083386771 11:62316807-62316829 GTGCAGAACCGAAAGGAAGATGG + Intergenic
1083578164 11:63807457-63807479 GAGCAGGTATGCAAGGCAGAAGG + Intergenic
1083783723 11:64931941-64931963 GAGGAGAAACTGAGGGCAAAGGG - Intronic
1085006453 11:73095609-73095631 GAGGAGAAAGGTAAGGCATAAGG + Intronic
1087737064 11:101846140-101846162 GAGAAGAGACAGAAGGCAGAGGG - Intronic
1087886336 11:103487454-103487476 AAGCAGTACAGGAAGGCAGAGGG + Intergenic
1088377087 11:109152859-109152881 GAGCAGATAGGGAAAGCAGGTGG - Intergenic
1088933779 11:114378444-114378466 GAGGAGGGAAGGAAGGCAGAAGG + Intergenic
1089398842 11:118152925-118152947 GAGCAGGAGCGGGAGGAAGACGG + Intergenic
1089555113 11:119311885-119311907 GACCTGAAACGGGAGGCAGGAGG - Exonic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090824485 11:130374650-130374672 AAAAAGAAACGGAAGGGAGAGGG + Intergenic
1091060716 11:132459100-132459122 GAACAGAACAGAAAGGCAGAGGG + Intronic
1091182350 11:133618362-133618384 GATGTGAAACGGAAGGCAGTTGG - Intergenic
1091539901 12:1450346-1450368 GAGTAAAATCAGAAGGCAGATGG - Intronic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1092746338 12:11675864-11675886 GAGAAGGAAAGGAAGGGAGAGGG + Intronic
1093232628 12:16566247-16566269 GAGCAGAGAGGGAAGGAGGAAGG + Intronic
1093744384 12:22722917-22722939 GAGCAAAAATGGAAAACAGAGGG + Intergenic
1096862725 12:54541567-54541589 GAGCAGAAACTGCAGGCTGAAGG - Intronic
1097037249 12:56131979-56132001 GAGCAGGAAGGGAATGCAGAGGG + Intronic
1097382103 12:58907510-58907532 GAGCAGAGACTGGAGGCAGTGGG - Intronic
1097633809 12:62097372-62097394 GAGAAGACACTGAAGGCATAAGG + Intronic
1097715844 12:62965165-62965187 GAGCAGAAAGAGAAGGGAAAGGG + Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099603730 12:84775033-84775055 GAGCAGATTCTGGAGGCAGAAGG + Intergenic
1100523749 12:95400822-95400844 TGGCAGAAAGAGAAGGCAGAGGG - Intergenic
1100882097 12:99030390-99030412 GAGGATAAAGGGAAGGCAGTGGG - Intronic
1101258785 12:103007729-103007751 GTGCAGAGACTGAAGGCAGGAGG + Intergenic
1101430664 12:104624252-104624274 GAGAAGAAAAAGAAGGGAGACGG + Intronic
1102562031 12:113769225-113769247 GAGGAGAAAATGAAAGCAGACGG + Intergenic
1103040336 12:117689984-117690006 AAGAAGAAAAGGAAGGAAGATGG + Intronic
1103170849 12:118818454-118818476 GGGGAAAAACTGAAGGCAGAAGG + Intergenic
1104013777 12:124949396-124949418 GAGCAGAAGCAGGAGGCAGAGGG + Intronic
1105421322 13:20254897-20254919 GAGCAGAAATAGAAGGGAGTAGG - Intergenic
1106052411 13:26204011-26204033 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1106482971 13:30150444-30150466 GAGAAGAAAGGGAAAGCAAAAGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107610409 13:42107342-42107364 GAGCAGACACTGCAGGCAGTGGG + Intronic
1107684523 13:42883692-42883714 GAACAGAAACTGATGGGAGAGGG - Intergenic
1108975523 13:56438929-56438951 GAGCAGAAACTTAAGGCAGCTGG + Intergenic
1111276222 13:85950917-85950939 GAGCAGAGTAGGAAGGGAGACGG - Intergenic
1111546538 13:89745236-89745258 GAGCAAAAAAGGAAGCCAGGTGG - Intergenic
1111996789 13:95173416-95173438 GAGCAGAAGAGAAAGGCAGGAGG + Intronic
1113048962 13:106187396-106187418 GAAGAGAGAGGGAAGGCAGAGGG + Intergenic
1113970655 13:114185869-114185891 GAACAGCAACAGGAGGCAGACGG + Intergenic
1114011644 14:18375545-18375567 GAGCAGAAACACAAAGCAAAAGG - Intergenic
1115522156 14:34243723-34243745 GAGCCTAAATGGAAGGCAGCAGG + Intronic
1115573784 14:34691710-34691732 GAGAAGAAACGAAATGCAGATGG - Intergenic
1115641341 14:35337465-35337487 GAGCAGAAAGTGAAGGCCCATGG + Intergenic
1116375839 14:44199564-44199586 GGGAAGAAAGGGAAGACAGAAGG + Intergenic
1117937904 14:60927699-60927721 GAGCAGAAACAGAAAGAAGGTGG - Intronic
1118803622 14:69214116-69214138 CAGCAATAACGGAAGCCAGAAGG - Intronic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1123459154 15:20452784-20452806 AAGCATAAACGTAATGCAGAAGG + Intergenic
1123658906 15:22547634-22547656 AAGCATAAACGTAATGCAGAAGG - Intergenic
1124312771 15:28642126-28642148 AAGCATAAACGTAACGCAGAAGG - Intergenic
1125011638 15:34883176-34883198 GAGATGAAACCCAAGGCAGAGGG + Intronic
1126859391 15:52869608-52869630 TAGCAGAAAGGAAGGGCAGAAGG + Intergenic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127065100 15:55229181-55229203 GAGAAGACAGGGAAGACAGAAGG - Intronic
1127715174 15:61642891-61642913 GAGTAACAACAGAAGGCAGAAGG + Intergenic
1128210365 15:65895671-65895693 GAGGAGAAGGGAAAGGCAGAGGG - Exonic
1128693034 15:69739737-69739759 GAGAAGGAAGGGGAGGCAGAAGG + Intergenic
1128926652 15:71662271-71662293 GAGGAGGAAGGGATGGCAGATGG + Intronic
1129087443 15:73110352-73110374 TAGCAGAAACTCAGGGCAGAAGG - Intronic
1129698457 15:77754101-77754123 GAGCAGAAAGGCAAGGGGGAAGG + Intronic
1130966240 15:88699949-88699971 GAGCTGAACTAGAAGGCAGAGGG + Intergenic
1131340813 15:91598964-91598986 GAGCAGCAAGGGCAGGTAGAGGG + Intergenic
1131999454 15:98164105-98164127 AAGGAGAAACTGAAGTCAGAGGG - Intergenic
1132061902 15:98699093-98699115 GAGAGGGAAAGGAAGGCAGAAGG + Intronic
1132843248 16:1988734-1988756 AAGCAGTAACGTAAGGCAGCTGG + Intergenic
1133908006 16:10039182-10039204 GAGTGGAAAAGAAAGGCAGAGGG + Intronic
1135236591 16:20762079-20762101 GAGCAGGAACCAAAGGAAGAGGG - Intronic
1136377756 16:29875611-29875633 GAGCAGAAAGGAATGGCAGCTGG - Intronic
1136626236 16:31463934-31463956 GGGGAGAAACGGAAGTGAGAGGG - Intronic
1137429379 16:48406229-48406251 GAGCAGAGACTGAAGGCTGAGGG - Intronic
1137777977 16:51072237-51072259 GAGCAGAAGCGATGGGCAGAGGG - Intergenic
1137879611 16:52032638-52032660 GAGAAGAAAGGCAGGGCAGATGG - Intronic
1138405216 16:56787519-56787541 GAGCAGGAAAGGATAGCAGAGGG - Intronic
1138615050 16:58158520-58158542 AATCAGAAGAGGAAGGCAGAGGG - Intronic
1138812532 16:60167523-60167545 TAACAGAAGAGGAAGGCAGAAGG + Intergenic
1139019402 16:62728660-62728682 GAGAAGAAATGGGAGGGAGAGGG + Intergenic
1140151578 16:72372582-72372604 GAGCAAACTCGGAAGGCAGCAGG + Intergenic
1140496129 16:75390494-75390516 TAGCAGAATCGGGAGGCAGGTGG - Intronic
1140626934 16:76805116-76805138 GACCTGCAAGGGAAGGCAGATGG - Intergenic
1140718373 16:77747827-77747849 TAGCTGAAACTGAAGGCTGATGG - Intergenic
1141537471 16:84692446-84692468 GAGGAGAGCAGGAAGGCAGAGGG - Intergenic
1142401537 16:89861177-89861199 GATAAGAAACCGAGGGCAGAGGG - Intronic
1142493661 17:294518-294540 GTGCAGAAATGGACGGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142772669 17:2110603-2110625 AAGCAGCAAAGGAAAGCAGACGG + Intronic
1143188127 17:5022720-5022742 GAGGAGAGAAGGGAGGCAGAAGG - Intronic
1144262927 17:13540808-13540830 GAGCAAAAGGGAAAGGCAGAAGG + Intronic
1144349466 17:14380894-14380916 GTGCAGAAACAGAAGAGAGAAGG + Intergenic
1147168313 17:38604837-38604859 GAGAAGATAGGGAAGGCAGGCGG - Intronic
1147252253 17:39159982-39160004 TACCAGAAATGGAAGGGAGAAGG - Intronic
1147947049 17:44086260-44086282 GAGAAGGAAGGGAAGGTAGAAGG + Intronic
1148091020 17:45022509-45022531 GAGTAGAAACTAAAGGCAGGAGG + Intergenic
1148744707 17:49911792-49911814 GAGGAGGGAGGGAAGGCAGAGGG + Intergenic
1149699838 17:58646254-58646276 GAGAAGAAACGAAAAACAGAGGG + Intronic
1150918479 17:69459870-69459892 AGGGAGAAAGGGAAGGCAGAAGG - Intronic
1150932703 17:69602521-69602543 GAGAAAAAATGAAAGGCAGAAGG - Intergenic
1151317042 17:73329393-73329415 CAGCAGCACCGGAAGGCACAGGG + Intergenic
1151834556 17:76574314-76574336 GAGCAGGAAGCTAAGGCAGAAGG + Intronic
1152361960 17:79836974-79836996 GAGGAGAGATGGAAGGCAGCGGG + Intronic
1152754139 17:82080075-82080097 GGGCAGGAACGGAAGGGGGAAGG - Intronic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1154297478 18:13163100-13163122 CAGCACAAACGGCAGACAGAGGG + Intergenic
1156493443 18:37510512-37510534 GAGCAGAGACGGATTGCACAGGG - Intronic
1156495898 18:37524974-37524996 GAGAAGAAAGGGAGGGCCGAGGG - Intronic
1157051953 18:44176514-44176536 GAGCAGGAATGGAAGGTAGACGG + Intergenic
1157221732 18:45833017-45833039 GAGCAGAATGGGAACACAGAGGG - Intronic
1159310262 18:66698469-66698491 GAGGAGAAAGGGAGGGAAGAAGG + Intergenic
1159571520 18:70119467-70119489 AAGGAGAAAGGGAAGGGAGAAGG + Intronic
1160072872 18:75643583-75643605 GAGCAGAGACTGAAGGAGGAGGG - Intergenic
1161448990 19:4334174-4334196 GATCAGAAACTCAAGGCAGGAGG - Intronic
1162341954 19:10096583-10096605 GAGGAGGAACGGAAGGAAGACGG + Intronic
1163105766 19:15122369-15122391 GAGGAGAAGAGGAAGGAAGAGGG + Intronic
1163167205 19:15506664-15506686 GAGCAGAGAAGCCAGGCAGATGG + Intergenic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163820876 19:19495979-19496001 GAGCGGGACCGGAAGGCACAGGG - Intronic
1164814492 19:31184888-31184910 GAGCAGAATGAGAAGGGAGAAGG + Intergenic
1164937069 19:32223320-32223342 GAGGAGAGAGGGAAGGAAGAAGG + Intergenic
1166207332 19:41279704-41279726 GATCATAAACGGAAGGCAGGAGG - Intronic
1166251881 19:41576953-41576975 GAGTAGGAACTGAAGGCAGTGGG + Intronic
1166255399 19:41600921-41600943 GAGCAGGACCTGAAGGCAGTAGG + Intronic
1166402693 19:42495408-42495430 GAGAGGAAAGGGAAGGGAGAGGG + Intergenic
1166445272 19:42853238-42853260 AAGCAGAAACAGAAGAGAGAAGG - Intronic
1167026048 19:46919111-46919133 GAGCAGAAACAAATGCCAGACGG + Exonic
1167195644 19:48026244-48026266 GAGCAGAGACAGCAGGCAGGAGG - Intergenic
1167707298 19:51089142-51089164 GGGGAGAAAAGGAAGGCAGATGG - Intergenic
1167750404 19:51375992-51376014 GAGCACAAAGGCAAGGCAGCTGG + Intergenic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
1168592863 19:57651608-57651630 GAGAAGGAACGGAATGGAGATGG - Intergenic
926001115 2:9333561-9333583 GAGAAGAAACAGAATGCAGAGGG + Intronic
926282962 2:11465595-11465617 GAGCAGATGCTGAAAGCAGAAGG + Intronic
926473019 2:13285065-13285087 CAGCAGAGAGGGGAGGCAGAGGG + Intergenic
927464920 2:23329649-23329671 GAGCAGAGACGAAAAGCAGAAGG + Intergenic
927619321 2:24635424-24635446 AAGCAGTAACTGAAGCCAGATGG - Intronic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
928688474 2:33775007-33775029 GAGGAGAAACAGAATGCAAAAGG - Intergenic
931492681 2:62766465-62766487 GAGCATACACGGATGGGAGATGG - Intronic
931983362 2:67718240-67718262 AATCAGACAAGGAAGGCAGAGGG - Intergenic
933611408 2:84439860-84439882 GATCAGAAAGGGAACTCAGATGG - Intronic
933905875 2:86891898-86891920 GATCAGATACGTAAGGCAGGAGG + Intergenic
933998371 2:87686435-87686457 GAGCAGGAAAGCAATGCAGAAGG + Intergenic
934216827 2:90038782-90038804 GTGCAGAGAGGGGAGGCAGATGG + Intergenic
934903103 2:98176534-98176556 TAGCTGAAAAGGAAGGCAGAAGG - Intronic
936083028 2:109447941-109447963 GAGCAGCAAATGCAGGCAGATGG + Intronic
936295478 2:111264438-111264460 GAGCAGGAAAGCAATGCAGAAGG - Intergenic
936643963 2:114347929-114347951 GAAGAGAAAGGAAAGGCAGAGGG + Intergenic
937490504 2:122362412-122362434 GTGCAGAACCCGAAGCCAGAAGG - Intergenic
937818214 2:126276433-126276455 AAGGAGAAAAGGAAGGGAGAAGG + Intergenic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
939732980 2:145808359-145808381 CAGCAGAAACAGCAGGGAGAGGG - Intergenic
939802955 2:146735675-146735697 GAGCTGAAGTAGAAGGCAGATGG - Intergenic
940187982 2:151007768-151007790 GAACAGAAAAGGAAGGGAGCAGG - Intronic
941495599 2:166198699-166198721 GAACAGAAAAGGAAGACAAAGGG - Exonic
942290522 2:174465480-174465502 GGGAAGATACTGAAGGCAGATGG - Intronic
942440280 2:176027849-176027871 AGGCAGAAAGGGAAGCCAGAAGG + Intergenic
942543959 2:177043588-177043610 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
943700228 2:190981171-190981193 GAGCAGCAGAGGAAGGCAGTGGG - Intronic
943992201 2:194710918-194710940 GAGCAGAAACCACAAGCAGAAGG + Intergenic
945422429 2:209655895-209655917 TAGCAAAAACGGAAAGTAGAGGG - Intronic
945685795 2:212968233-212968255 GAGAAGGAAAGGAAGGCTGAGGG + Intergenic
946107217 2:217381647-217381669 GAGAAAAAGCGGAAGGCACAGGG - Intronic
946224230 2:218254389-218254411 GAGAAGAGAAGGAAGGAAGAAGG + Intergenic
946242157 2:218362987-218363009 GAGTAGAAAAGGGAGGCAGGTGG + Intronic
947224799 2:227829672-227829694 AATCAGAAAATGAAGGCAGAGGG - Intergenic
947267123 2:228295111-228295133 GGGCTGAAACGGAAGGAAGGTGG + Intergenic
947511003 2:230754367-230754389 GAGGGGAAGAGGAAGGCAGAAGG - Intronic
948228833 2:236334911-236334933 GTGGAGAAACGGAAGCCCGAAGG + Intronic
1169771443 20:9205762-9205784 GAGGAGAGAAGGAAGGGAGATGG - Intronic
1170075230 20:12411460-12411482 TAGCATAAACAGAAGGCAAAGGG - Intergenic
1170770969 20:19332260-19332282 GAGCAGGAACAGAAGCCAGTGGG + Intronic
1171473389 20:25390081-25390103 CAGCAGAGGCGGGAGGCAGAGGG - Intronic
1172815824 20:37685149-37685171 GAGGAGGAAGGGAAGGAAGAGGG + Intergenic
1173313508 20:41921933-41921955 GAGGAGAAAAGAAAGGCAGAAGG - Intergenic
1175130088 20:56782338-56782360 GGGAAGAAAAGGAAGGAAGAAGG + Intergenic
1175301716 20:57947714-57947736 GAGCAGAGACAGAGGGCTGAGGG + Intergenic
1175819979 20:61903974-61903996 GAGCAGAAACGCAAAACAGCTGG - Intronic
1175823701 20:61925157-61925179 GGGCAGAGACGGCAGGAAGAAGG + Intronic
1177299257 21:19219574-19219596 AAGCAGAAGGGGAAGGGAGAAGG + Intergenic
1177593093 21:23198975-23198997 AAGCAGCAAAGGAAGGAAGAAGG - Intergenic
1177900984 21:26914747-26914769 AAGCAGAAGAGAAAGGCAGAAGG - Intergenic
1179167950 21:38949257-38949279 AAGAAAAAAGGGAAGGCAGAAGG - Intergenic
1179490207 21:41736340-41736362 GAGAAGAAAGGGAAGAAAGAAGG + Intergenic
1180436137 22:15306353-15306375 GAGCAGAAACACAAAGCAAAAGG - Intergenic
1180892077 22:19296736-19296758 AAGCTGAAAGGGAAGTCAGAAGG + Intergenic
1181085314 22:20437008-20437030 GACCAGAAGCGGGAGGCGGAAGG - Intronic
1181406009 22:22685647-22685669 GAGCTGGAAGGAAAGGCAGAGGG - Intergenic
1181413985 22:22746350-22746372 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181419630 22:22788873-22788895 GAGCTGGAAGGAAAGGCAGAGGG - Intronic
1181568342 22:23752828-23752850 GGGCAGAAATGGGAGGCAGAGGG + Exonic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1184062016 22:42089019-42089041 GAGGAGGAAAAGAAGGCAGAGGG - Intronic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184950647 22:47840371-47840393 GAGAAGAAAAGGAAGTCAGGAGG - Intergenic
949988568 3:9559170-9559192 GTGCAGAAATGGAACTCAGATGG - Intergenic
951554037 3:23902899-23902921 GAGCAGAAAGGGAAAGCCGGAGG - Intronic
952521596 3:34164473-34164495 GAAAAGAAAGGGAAGGAAGAAGG - Intergenic
952958687 3:38576483-38576505 GGGCAGACACGTCAGGCAGATGG + Intronic
953739372 3:45523864-45523886 AAGCAGAAATGGATGGCAAAGGG + Intronic
955307446 3:57848530-57848552 GAGGAAAAAGGGAAGGAAGAAGG - Intronic
956345514 3:68273563-68273585 GAGAACAACCTGAAGGCAGATGG + Intronic
956668320 3:71662879-71662901 GGGCAGAAACCGAGGGAAGATGG + Intergenic
956704096 3:71984432-71984454 GAGAAGAAACGAGAGGGAGATGG - Intergenic
956797602 3:72730809-72730831 AAGCAGACATGGAAGGAAGAAGG - Intergenic
956798339 3:72735914-72735936 AAGCAGACATGGAAGGAAGAAGG - Intergenic
957508850 3:81160907-81160929 GAGGAGTAAAGGAAGGAAGATGG + Intergenic
957765451 3:84619279-84619301 GTGCAAAAAAGAAAGGCAGAGGG + Intergenic
957899935 3:86476212-86476234 GAGAAGAGAGGGAAGGGAGAGGG + Intergenic
959440220 3:106365080-106365102 GAGGAAAAAAGGAAGGAAGAAGG - Intergenic
959901299 3:111664508-111664530 GAGCATAAAGGGAAGGAGGAAGG + Intronic
960088538 3:113615872-113615894 CAGCAGAAAGGCAAGGAAGATGG - Intronic
960944829 3:122958699-122958721 GACCAGAGAGGCAAGGCAGAGGG + Intronic
960988811 3:123297284-123297306 GAGCAGACAGGGAGGGCAGCTGG - Intronic
962255771 3:133869185-133869207 GAGAAGAAACAGAAGGCAACAGG + Intronic
962455993 3:135566245-135566267 AAGGAGAATTGGAAGGCAGATGG + Intergenic
962924226 3:139976961-139976983 GAGCAGGAAGAGGAGGCAGATGG - Intronic
963254163 3:143128248-143128270 GAGAAGAAATGGGAGGCAGGGGG - Intergenic
963819117 3:149868608-149868630 GAACAGAAAGGGAAAGGAGAGGG - Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
966269668 3:178090144-178090166 GAACAGAAAGGCAAGGCAAAAGG + Intergenic
966422520 3:179747464-179747486 GAGCAGAAAGGGGTGGCCGAGGG - Intronic
966778661 3:183564706-183564728 CAGCAGAAACAGGAGGCAAAAGG + Intergenic
967108705 3:186273954-186273976 GAGCAGGAGGAGAAGGCAGAGGG - Intronic
967830192 3:193912152-193912174 AAGCAGAGATGGCAGGCAGAAGG - Intergenic
969591821 4:8126458-8126480 GAGGAGAAAAGGGAGGCAGGGGG - Intronic
970479939 4:16462565-16462587 GAAAAGAAATGGAAGGCAAATGG + Intergenic
970730283 4:19095137-19095159 GAGAAGAAAGAGAAGGAAGAGGG + Intergenic
972170714 4:36342353-36342375 GTTCAGTAATGGAAGGCAGATGG + Intronic
973094044 4:46175167-46175189 TAGCAGAAAGGGAAGAGAGAAGG + Intergenic
973712516 4:53643624-53643646 GAGGAGAAAGGGAAGAGAGAGGG - Intronic
973983002 4:56322461-56322483 AAACAGAGACGGAAGTCAGAAGG + Intronic
976390546 4:84500050-84500072 GAACAGAAAAGGAAAGCAGGAGG - Intergenic
976476526 4:85490108-85490130 GGGCAGAAATGGGAGGGAGAGGG + Intronic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978901089 4:113950288-113950310 GAGCATAAAAGGAAGGGGGAGGG - Intronic
979451971 4:120883166-120883188 GAGAAAAAAATGAAGGCAGAAGG - Intronic
980586668 4:134826343-134826365 GAGGAGCAACTGAAGGCATAAGG + Intergenic
980913848 4:139016313-139016335 GAGGAAAAAGGGAACGCAGAAGG - Intronic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
985169095 4:187129120-187129142 AAACAGAAAAGGAAGGAAGAAGG + Intergenic
986040272 5:3987396-3987418 GAGAAGAAACAGGAGGCAGTTGG - Intergenic
986324503 5:6662002-6662024 CAGCAGAGAGGGAGGGCAGAAGG - Intronic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986940628 5:12945021-12945043 GAACATAAACTGAATGCAGATGG + Intergenic
986994695 5:13593622-13593644 GAGTAGAAAGGGATGGGAGATGG - Intergenic
987397990 5:17443583-17443605 GAGCAGACAGGGGAGACAGAAGG - Intergenic
988909031 5:35821108-35821130 GAGAAGATACAGAAAGCAGAGGG - Intergenic
989125716 5:38050701-38050723 ATGCAGAAGAGGAAGGCAGAAGG + Intergenic
991592011 5:68261883-68261905 CAGCAGAAAGGGAAGGGATAGGG - Intronic
991970323 5:72134821-72134843 GAGTAGAAAAGGAAGGCAGGCGG + Intronic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
992632727 5:78697612-78697634 GAGAAAAAATGGAAGGCAGCAGG - Intronic
993052302 5:82939811-82939833 GAGCAGATATGAAAGACAGAGGG - Intergenic
993120571 5:83769144-83769166 GAGCATAGATGGAAGGCAAAAGG - Intergenic
993155405 5:84215836-84215858 CAGTAGAAACTGAAGCCAGAAGG + Intronic
993550762 5:89271016-89271038 GAGCAAAAACGGAGAGCAGATGG - Intergenic
994146812 5:96404487-96404509 GAGGAGAAAAGGAAAGGAGAAGG - Intronic
994300596 5:98142528-98142550 GAGAAGAGACTGAAGGCAGCAGG - Intergenic
994363784 5:98886984-98887006 GGGCAGAAGAGGAAGGCAAATGG + Intronic
995054606 5:107745407-107745429 GTGCAGATAGGGAAGGTAGAAGG - Intergenic
995319650 5:110819033-110819055 GATAAGATACAGAAGGCAGAAGG - Intergenic
995832055 5:116364155-116364177 TAGCAGATATGGATGGCAGATGG + Intronic
996284466 5:121771924-121771946 CACCAGAAACTGAAGGAAGAGGG - Intergenic
996386634 5:122915764-122915786 GAGCAGCTAAGGTAGGCAGAGGG - Intronic
997259210 5:132453139-132453161 GAGAAGAAAAAGAAAGCAGAAGG - Intronic
999081481 5:148848312-148848334 GAACAGAAAAGGAAGGAGGAAGG - Intergenic
999654918 5:153801977-153801999 GAGCTGAAAAGGAAGGGACATGG + Intronic
999844755 5:155467030-155467052 GAGCTGGAAAGGAAGCCAGAAGG - Intergenic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1001216772 5:169863854-169863876 GTGCAGACCCGGAAGGTAGAGGG - Intronic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002787727 6:417238-417260 GAGCAGAGGCAGAGGGCAGAGGG - Intergenic
1002829880 6:810249-810271 GAGAAGAAAAGACAGGCAGAGGG + Intergenic
1003559217 6:7167196-7167218 CAGCAGCAACTGAAGTCAGAGGG + Intronic
1004529057 6:16436704-16436726 GAGCAGGAAATGAAGTCAGAGGG + Intronic
1004915898 6:20331876-20331898 CAGCAGAAAAGAAAGCCAGAAGG + Intergenic
1005115031 6:22326767-22326789 GATCCCAAACGGAAAGCAGATGG + Intergenic
1005247436 6:23904172-23904194 GAGCAACAATGGAAAGCAGAAGG + Intergenic
1005372914 6:25153838-25153860 GAGAAGAAAGGGAGGTCAGATGG - Intergenic
1005806592 6:29479011-29479033 GCGCAGAGACAGAAAGCAGATGG - Intergenic
1005814795 6:29541768-29541790 GTGCAGAAATGGAAGGTAGATGG - Intergenic
1006030578 6:31174050-31174072 GGGAAGAAACGGAGGGCTGAGGG + Intronic
1006257888 6:32845533-32845555 GAGAAGAAAAGGGAGGGAGATGG + Exonic
1006574930 6:35038044-35038066 GAGGGGAAAAGGAAAGCAGAGGG + Intronic
1007119939 6:39371362-39371384 GAGCCCAGACAGAAGGCAGAGGG - Intronic
1007123102 6:39399968-39399990 GAGCAGATAAGGAAGACAGAGGG + Intronic
1007937027 6:45741578-45741600 GGGCAGAAACAGGAGGGAGAGGG - Intergenic
1008443147 6:51556020-51556042 GAACAGAAAGGGAAGGAGGAAGG + Intergenic
1009058175 6:58364451-58364473 GAGAAGAAATGGAAAGCTGAGGG + Intergenic
1009232650 6:61082662-61082684 GAGAAGAAATGGAAAGCTGAGGG - Intergenic
1010287524 6:74096495-74096517 TAGCAGAAATGTAAGTCAGAAGG + Intergenic
1011097116 6:83678684-83678706 GAGCAGGAGTGGAAGGTAGAAGG - Intronic
1011791236 6:90901403-90901425 GAGCAGAAAGTAAAGTCAGAGGG - Intergenic
1011902142 6:92312402-92312424 GAAAAGAAAAGGAAGGAAGATGG - Intergenic
1012854125 6:104481101-104481123 GAGAAGGAACAGAAGTCAGATGG + Intergenic
1015712152 6:136153869-136153891 GAGCAGAGATGGACAGCAGAGGG - Intronic
1015920991 6:138266325-138266347 GAGAAAGAAGGGAAGGCAGAAGG + Intronic
1016324561 6:142885324-142885346 GAGAAGAAAGGGGAGGGAGAAGG - Intronic
1017112848 6:150948975-150948997 GAGAAGAAACAGAAAGCAAAGGG - Intronic
1017743499 6:157427093-157427115 GAGAAGAGAGGGAAGGAAGAGGG + Intronic
1019163859 6:170086685-170086707 GAGCAGGCGGGGAAGGCAGAAGG + Intergenic
1021820481 7:24493158-24493180 GAGCAGAGACAGTAGGCAGTTGG + Intergenic
1022979338 7:35589466-35589488 AAGAAGAAATGAAAGGCAGAAGG - Intergenic
1023156462 7:37256769-37256791 GAGGAGGAAGGGAAGGGAGAAGG + Intronic
1023353993 7:39349310-39349332 GTGAAGAAAAGGAAGGAAGAAGG - Intronic
1023376909 7:39565824-39565846 GAACAGGAATGGGAGGCAGAAGG + Intergenic
1023744777 7:43312938-43312960 GAGCACAGACTGAAGGCAGAAGG - Intronic
1023837694 7:44077978-44078000 GAGCAGAAACAGAGGGAAGGTGG + Intronic
1023966814 7:44967097-44967119 AAGGAGAGAAGGAAGGCAGATGG - Intronic
1023984678 7:45087889-45087911 GAGCAGAAACCAAAGGCCAAAGG + Intronic
1024752770 7:52487587-52487609 GAGCAGACAGGGAAGGCTGTGGG - Intergenic
1025028502 7:55537063-55537085 GACGAGAAACGCAATGCAGATGG + Intronic
1026452017 7:70537805-70537827 GAGCAGAAATGGAAGTAAGAAGG + Intronic
1026552539 7:71380649-71380671 GAGTAGAAAAGGTTGGCAGAGGG + Intronic
1027733686 7:81906527-81906549 GAGCTGAAAGGGAAGGAAGCTGG + Intergenic
1028127774 7:87133957-87133979 AAGTAGATAAGGAAGGCAGAAGG + Intergenic
1028285189 7:88987969-88987991 GAGAAGAAAAGGAAGGAGGAGGG - Intronic
1028532278 7:91851405-91851427 GTGCAGAAAAGGAAAGCAGCAGG + Intronic
1028621964 7:92835603-92835625 GAGCAGAGACAGAAAGCAGAAGG - Intronic
1030524679 7:110638840-110638862 GAGAGGAAAAGGAAGGCAGAAGG - Intergenic
1031089260 7:117333966-117333988 GAGCTTAAAAGGAGGGCAGAAGG + Intergenic
1031326437 7:120404805-120404827 GAGAAGAAAGGGAAGGAAGGAGG - Intronic
1031739221 7:125407764-125407786 AAGTGGAAAAGGAAGGCAGAAGG + Intergenic
1032803477 7:135334953-135334975 GAGCTGAGAAGGAAGGGAGAGGG + Intergenic
1032894228 7:136233141-136233163 GTGTAGAAAAAGAAGGCAGAGGG + Intergenic
1033352911 7:140576787-140576809 GAGCACAAAAAGAAGGAAGAGGG + Intronic
1033437614 7:141347720-141347742 GAGGAGACAGAGAAGGCAGACGG - Intronic
1033742284 7:144284479-144284501 GAGCAGAAATGGGAGGAAGGTGG + Intergenic
1033751618 7:144365135-144365157 GAGCAGAAATGGGAGGAAGGTGG - Exonic
1033897669 7:146094606-146094628 GACCAGAAGAGAAAGGCAGACGG - Intergenic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1035785820 8:2260016-2260038 AGGCAGAAGCGGGAGGCAGAAGG - Intergenic
1035806987 8:2461700-2461722 AGGCAGAAGCGGGAGGCAGAAGG + Intergenic
1036124221 8:6048292-6048314 GAGCAGAAAACCAAGGCAGCAGG + Intergenic
1036391103 8:8325030-8325052 GAGCCGGCACTGAAGGCAGACGG - Intronic
1036751856 8:11448705-11448727 GAGCAGAGAGGGAAGGGAGCAGG - Intronic
1038338571 8:26664742-26664764 GGGCAGAAAGGGAAGACAGGAGG - Intergenic
1038390075 8:27189363-27189385 GAGGAGAAAGGGAAGGAAGGAGG + Intergenic
1038416918 8:27403873-27403895 GAGAAGAAAAGGAAGAAAGAAGG - Intronic
1038686008 8:29719113-29719135 GAGGGGAAGCGGAAGGCAGCAGG - Intergenic
1038925513 8:32135119-32135141 GAGAAGAAAAGGTAGGAAGAAGG + Intronic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041953610 8:63533127-63533149 GAGGAGAAAAGGAAGGAAGGTGG - Intergenic
1042845969 8:73169788-73169810 GAGCAGACTAGGAAGGCAGGTGG + Intergenic
1043004017 8:74795989-74796011 GAGCAGCAATGGAAAGCAGAGGG + Intronic
1044517501 8:93156358-93156380 AAGCAGACATGGAAGACAGAGGG - Intronic
1045030497 8:98130547-98130569 GAGGAGAGGGGGAAGGCAGAAGG + Intronic
1045174829 8:99711222-99711244 TAGCAGACAAGGAAGGCACATGG + Intronic
1045610756 8:103838305-103838327 TAGCAGAAAAGGAAGTGAGAAGG - Intronic
1047552442 8:125889605-125889627 GAGCAGCAAAGAAAGGAAGAAGG - Intergenic
1047601305 8:126428547-126428569 GAGCAGAAGAAGAAGTCAGAGGG - Intergenic
1048247293 8:132820606-132820628 AAGCAGGAAGAGAAGGCAGATGG - Intronic
1048550673 8:135431016-135431038 GAGCAGGAAAGGACTGCAGATGG - Intergenic
1049351496 8:142167134-142167156 GAGCAGAAGTGCCAGGCAGATGG + Intergenic
1050413102 9:5386673-5386695 GAACAGAAACAGATGTCAGAAGG - Intronic
1050799231 9:9588228-9588250 CAGCAGAATTGGAAGACAGAAGG + Intronic
1051106877 9:13590419-13590441 GATAAGAAAGGGAAGGAAGAGGG + Intergenic
1051650852 9:19322778-19322800 GAGCAGAGAGGGAAGGCTCATGG - Intronic
1053061590 9:35036248-35036270 TAGCAGAAGGGAAAGGCAGAGGG + Intergenic
1054804240 9:69382495-69382517 GACCTGAAGGGGAAGGCAGAAGG - Intronic
1054882847 9:70163164-70163186 GAGCAGAAATGCAAGGCAGATGG - Intronic
1055690640 9:78826710-78826732 GAGCAGAAGAGGGAGGCAGGTGG + Intergenic
1056089193 9:83187743-83187765 GAGGAGAAATGGAAGGTAGAGGG - Intergenic
1056227773 9:84513039-84513061 GAGCAGATAGGGATGTCAGAGGG + Intergenic
1056533866 9:87510973-87510995 GAGCAGGAACGGGAGAGAGAGGG + Intronic
1056793253 9:89639777-89639799 GAGGAGAAAGGAAAGACAGAGGG - Intergenic
1058041930 9:100312204-100312226 GGGCAGCAAGGGGAGGCAGAAGG - Intronic
1058472947 9:105299746-105299768 CAGCAGACACAGAAGGCAGCAGG - Intronic
1058939353 9:109798952-109798974 GAGGGGAAACGGAGGGCAGCAGG - Intronic
1059589052 9:115637727-115637749 AAGCAAAAGGGGAAGGCAGAGGG + Intergenic
1059669312 9:116477977-116477999 GAGAAGAAACAGAGGGCAGAGGG + Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1060791145 9:126486581-126486603 GAGCAGAACGGGAGGGGAGATGG - Intronic
1062154205 9:135037339-135037361 CAGCAGGCACAGAAGGCAGAGGG + Intergenic
1062332941 9:136052517-136052539 GCACAGAAACGGCAGGCAGTGGG + Intronic
1062678082 9:137760063-137760085 CAGCAGCAACAGGAGGCAGAGGG + Intronic
1203653026 Un_KI270751v1:146638-146660 GAGCATATAGGGAAGGCAGGAGG + Intergenic
1185611949 X:1398340-1398362 TAGCAGACACTGAAGGGAGAGGG + Intergenic
1185867512 X:3636922-3636944 GAACAGAAAGGAAAGGAAGAAGG + Intronic
1187589379 X:20699740-20699762 ATGCAGAAATTGAAGGCAGATGG + Intergenic
1189946269 X:46182839-46182861 TAGCAGCAATGGAAGGCAGATGG - Intergenic
1190013456 X:46805528-46805550 GAGCAGAAACGGAAGCTGCAAGG - Intergenic
1190594881 X:52042374-52042396 GAGGAGAACGGAAAGGCAGAGGG - Intergenic
1190613943 X:52211699-52211721 GAGGAGAACGGAAAGGCAGAGGG + Intergenic
1191869910 X:65737153-65737175 GAGCAGAAAAGGAGGGGAGAAGG - Intronic
1192945086 X:75957676-75957698 GAGCAGAATCTGAAAGTAGAGGG - Intergenic
1193428433 X:81369902-81369924 GAGCAGAACCTGAAGGCAGTTGG + Intergenic
1197187238 X:123601429-123601451 TAGGAGAAAAGGAAGGGAGAAGG + Intronic
1198234713 X:134726148-134726170 GAGAAGGAACAGAAGCCAGAAGG - Intronic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199272415 X:145899319-145899341 CTGCAGAAATGGAAGGCAGCAGG - Intergenic
1199392360 X:147295855-147295877 GAGAAGAAACAGAGGGCACAGGG - Intergenic
1199984699 X:152942029-152942051 GTGCAGACAGGGAAGGCAGCTGG + Intronic
1201238082 Y:11930794-11930816 CAGCAGATAGGGGAGGCAGAGGG - Intergenic
1202330025 Y:23739565-23739587 TAGCAAAAAAGGAAGGAAGAAGG + Intergenic
1202540745 Y:25930489-25930511 TAGCAAAAAAGGAAGGAAGAAGG - Intergenic