ID: 916168489

View in Genome Browser
Species Human (GRCh38)
Location 1:161983713-161983735
Sequence CATTGTCCCAGGCATAGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 233}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916168489 Original CRISPR CATTGTCCCAGGCATAGAGC AGG Exonic
901884734 1:12215018-12215040 CACTGTCCCAGGCCAAGGGCAGG - Intergenic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
902685929 1:18077690-18077712 CATAGTGCCTGGCACAGAGCAGG + Intergenic
904955076 1:34276200-34276222 CAGTGGCCCAAGCATAGATCTGG - Intergenic
905180129 1:36160465-36160487 CATTGTGCCTGGCACAGAGAAGG - Intronic
906195011 1:43924664-43924686 CATTGTCTCAGCCAAAGATCTGG - Intronic
907077855 1:51594566-51594588 CATTGTCCCTAGCATATAGTTGG - Intronic
907754513 1:57298078-57298100 CATAGTCCCAGGAATGGAGAGGG - Intronic
907835425 1:58104131-58104153 CAGTGTGCCAGGCACAGAGAGGG + Intronic
908793586 1:67808374-67808396 CTTTTTCCTAGTCATAGAGCAGG - Intronic
909846769 1:80403842-80403864 CATTGTCCATGGCATAAATCTGG - Intergenic
910207311 1:84761095-84761117 CACTGTCCCTGGCTTTGAGCTGG + Intergenic
910303600 1:85736150-85736172 CATTGTTCCTGGCACAGAGCAGG + Intronic
910982878 1:92976119-92976141 CTTTGTACCAGGCATCCAGCTGG - Intergenic
910995322 1:93098460-93098482 CATGGTACCTGGCATATAGCAGG + Intronic
911527681 1:99005243-99005265 CATTTTCCCAGGCGTTGTGCGGG - Intergenic
911806052 1:102210090-102210112 CATAGTCCCAAGCTTAGTGCAGG + Intergenic
912527912 1:110298473-110298495 CAATGTGCCAGGCATAGAGTTGG + Intergenic
912933112 1:113981694-113981716 CATCATCCCAGGCATAGAGCTGG - Exonic
913966351 1:143380540-143380562 CATAGTCCCTGGCATACAGCAGG - Intergenic
914060724 1:144206147-144206169 CATAGTCCCTGGCATACAGCAGG - Intergenic
914118426 1:144760222-144760244 CATAGTCCCTGGCATACAGCAGG + Intergenic
916168489 1:161983713-161983735 CATTGTCCCAGGCATAGAGCAGG + Exonic
916824273 1:168429156-168429178 CACTGTCCCTAGCACAGAGCAGG - Intergenic
917724890 1:177818976-177818998 CATAGTCCCTGGCATACAGAAGG + Intergenic
920782837 1:209011449-209011471 AATTATCACTGGCATAGAGCAGG - Intergenic
924282788 1:242454876-242454898 GATGGTCCCAGGGATAGAACCGG - Intronic
1065573240 10:27093708-27093730 CGTTGTCACAGACATTGAGCTGG + Exonic
1066191450 10:33059687-33059709 AATTGACCCTGGCATAGAGTTGG - Intergenic
1066622988 10:37378167-37378189 CATTGTCACAGGGACAGAGGAGG - Intronic
1066706570 10:38185866-38185888 CATTATTCCAGGCAGAGAACGGG + Intergenic
1068486194 10:57662188-57662210 CACAGTGCCTGGCATAGAGCTGG + Intergenic
1070365685 10:75734634-75734656 CATTGTGCCTAGCAAAGAGCAGG - Intronic
1071504011 10:86222140-86222162 CATCCTCCCAGGCCTAGAGGGGG + Intronic
1071598684 10:86945518-86945540 CATTTGCCCAGGCCTGGAGCGGG - Intronic
1073142105 10:101254905-101254927 CCTTGTGCCAGGCATTGAGAAGG + Intergenic
1073645993 10:105304584-105304606 AATTGTCTCAGGAATAGAGGTGG - Intergenic
1074052855 10:109895625-109895647 CCTTCTCCCAGGCATGAAGCTGG + Intronic
1074079010 10:110152713-110152735 CAGGGGCCCAGGCAGAGAGCAGG - Intergenic
1074237295 10:111598479-111598501 CCTTGTCCTAGGCGTAGAGCAGG - Intergenic
1075582924 10:123635618-123635640 CATAGTGCCTGGCACAGAGCAGG + Intergenic
1076035900 10:127197734-127197756 CTTGGTCACAGGCACAGAGCTGG - Intronic
1076137604 10:128055787-128055809 CATGGACCCTGGCCTAGAGCAGG - Intronic
1076791373 10:132778721-132778743 CACTGTCCCAGGCCCAGAGCAGG + Intronic
1078425290 11:11244782-11244804 CACAGTCCCTGGCACAGAGCAGG + Intergenic
1081644682 11:44781428-44781450 CAGTGTCCCAGCCATCGAGAAGG - Intronic
1083168947 11:60910757-60910779 CATTGTGCCTGGCACATAGCAGG + Intergenic
1087106344 11:94412154-94412176 CATGGTGCCTGGCATAGAGCAGG - Intergenic
1088543748 11:110939401-110939423 CATTTTCACAGGCTAAGAGCAGG - Intergenic
1089081000 11:115776118-115776140 AATTTTCCCAGGCATTGGGCTGG - Intergenic
1090054570 11:123411368-123411390 CATGGTGCCTGGCATATAGCAGG + Intergenic
1092681944 12:10992964-10992986 CATTGTCCAAGGAATAGAATTGG + Intronic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1094499245 12:31007890-31007912 CATTCTCACAGCCATAGAGGCGG + Intergenic
1098277786 12:68831071-68831093 CAGTGTCCCAGGTACAAAGCAGG - Intronic
1101655587 12:106717190-106717212 CAATGGGCCAGGCACAGAGCAGG + Intronic
1104843893 12:131837228-131837250 CCTTGCCCCAGGCACACAGCGGG + Intronic
1107521635 13:41187849-41187871 CATGGTCCAAGGCACAGGGCAGG - Intergenic
1109092128 13:58061415-58061437 GATTGTCCCATGCACAGGGCTGG - Intergenic
1109118925 13:58428907-58428929 CATTGGCCCAGGTAGAGAGGAGG + Intergenic
1109158742 13:58945580-58945602 CATTGTCCCAGGCTTAATCCTGG - Intergenic
1110689192 13:78412186-78412208 CATAGTGCCTGGCACAGAGCCGG + Intergenic
1111946921 13:94675761-94675783 CTTAGTGCCAGGCATAGAGTAGG - Intergenic
1112414492 13:99192963-99192985 GCTTGGCCCATGCATAGAGCAGG + Intergenic
1112780093 13:102890914-102890936 CTGTGTCCCAGGCACAGTGCTGG - Intergenic
1113171878 13:107513672-107513694 CATTGTCCCAGCACTAGCGCTGG + Intronic
1115311942 14:31987662-31987684 ATATGTCCCAGGCAGAGAGCGGG + Intergenic
1117411142 14:55452228-55452250 CATGGTGCCTGGCATAGTGCTGG + Intronic
1121482855 14:94291810-94291832 TTTTGTCCCAGGCATAGATAAGG - Intronic
1121521112 14:94586864-94586886 GATGGTCCCAGGCATGTAGCTGG + Intronic
1121554881 14:94828981-94829003 CATTGTGCCTGGCACACAGCAGG - Intergenic
1122344722 14:101051373-101051395 CCGTGTCCCAGGCAGAGAGGGGG + Intergenic
1122630015 14:103103465-103103487 CCTCATCCCAGGCAGAGAGCGGG - Intronic
1124816332 15:32997585-32997607 CATGGTACCTGGCACAGAGCTGG + Intronic
1126238409 15:46412662-46412684 CATTGTCCCAGCCAAAAAGTGGG + Intergenic
1127864195 15:63018558-63018580 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1128330395 15:66751766-66751788 CATGGTGCCAGGCACAGAGCAGG + Intronic
1133557959 16:6923581-6923603 CATTTTCCAGGGCAGAGAGCAGG + Intronic
1133896174 16:9931380-9931402 CATGGTGCCAGGCATGGAGAAGG - Intronic
1134040592 16:11065478-11065500 CACTGTGCCTGGCATACAGCAGG - Intronic
1136614681 16:31390683-31390705 CTTTCTCCCAGGCCTGGAGCTGG - Intergenic
1137394129 16:48105053-48105075 CAGTGTGCCAGGCATGGTGCTGG - Intronic
1137492424 16:48944213-48944235 TATTGCCCCAGGGATTGAGCTGG + Intergenic
1138143734 16:54589746-54589768 CTGTGTGCCAGGCATAAAGCAGG - Intergenic
1138328360 16:56193057-56193079 CACTGCCCCAGGAAAAGAGCAGG - Intronic
1139084338 16:63565959-63565981 CATTGTGCCTGACATAGAGTAGG - Intergenic
1140055493 16:71522027-71522049 AATTGTCCCAGGAGTAGAGTTGG - Intronic
1142145262 16:88490374-88490396 CTGTGTGCCAGGCATATAGCCGG + Intronic
1143386951 17:6536613-6536635 CACTGTTGGAGGCATAGAGCTGG + Intronic
1144156666 17:12510921-12510943 CATTGTACCTGGCACAGAGCTGG - Intergenic
1144247811 17:13384796-13384818 CATTGTTCCAGCCATACAGAAGG + Intergenic
1146477479 17:33174611-33174633 CCTCCTCCCAGGCATACAGCAGG + Intronic
1146608882 17:34287359-34287381 CAATCTCCCAGGCAGGGAGCTGG - Intronic
1147488420 17:40841033-40841055 CATAGTGCCAGGTACAGAGCAGG + Intergenic
1147870715 17:43585510-43585532 CATTGTGCCAGGCATTGTCCTGG - Intergenic
1150505327 17:65692816-65692838 CTGTGTACCAGGCATTGAGCTGG - Intronic
1151024976 17:70668060-70668082 CCCTGTCCCAGGCATACAGTAGG + Intergenic
1151686344 17:75649036-75649058 CAATGTGCCTGGCACAGAGCTGG + Intronic
1153409153 18:4774217-4774239 CTTTCTCCCAGGTATAGACCAGG + Intergenic
1153928328 18:9855450-9855472 TATTTACACAGGCATAGAGCAGG - Intronic
1155505284 18:26527041-26527063 TAATGTCCCAGGCAGAGGGCAGG - Intronic
1156654742 18:39271877-39271899 CATTGTCCCAGGCTAAGAGCAGG - Intergenic
1157208603 18:45721597-45721619 GATTGTTCCAGGCAGAGAGATGG + Intergenic
1157314212 18:46574879-46574901 CATTGTCACATGCATGGTGCTGG - Intronic
1157499290 18:48178807-48178829 CAGTGTCTCAGACACAGAGCAGG - Intronic
1158658314 18:59360579-59360601 CTCTGTGCAAGGCATAGAGCTGG - Intergenic
1159470639 18:68850781-68850803 CATGGACCCAGCCATTGAGCAGG - Intronic
1159854148 18:73564324-73564346 CATTGTCTCATACATAGAGTTGG - Intergenic
1161335760 19:3712381-3712403 CAGTGTCCCAGGGCTAGAGGGGG - Intronic
1161410140 19:4112535-4112557 CAAGGTCACAGGCCTAGAGCAGG - Intronic
1161991666 19:7687652-7687674 CATTCTCCGTGTCATAGAGCAGG + Exonic
1163587528 19:18172286-18172308 CTTGGTGCCAGGCATAGAGTGGG - Intronic
1163817023 19:19472867-19472889 CATAGTACCTGGCATACAGCAGG - Intronic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165749868 19:38253187-38253209 CATGGGCCCAGGCATCGGGCTGG - Intronic
1166703033 19:44893115-44893137 CATGGGGCCAGGCAGAGAGCAGG - Intronic
1202700132 1_KI270712v1_random:158035-158057 CATAGTCCCTGGCATACAGCAGG - Intergenic
925351170 2:3201515-3201537 CATGGACCCAGACACAGAGCGGG + Intronic
925370334 2:3340275-3340297 CAATCTCCCAGGAGTAGAGCGGG + Intronic
925416404 2:3672979-3673001 CATTGTGCCAGTCACAGGGCTGG - Intronic
925438824 2:3866500-3866522 CATGCAGCCAGGCATAGAGCCGG - Intergenic
927475450 2:23411079-23411101 CACTGTGCCTGGCACAGAGCAGG - Intronic
928334561 2:30385529-30385551 CCTTTTCCCAGACATGGAGCAGG - Intergenic
929531594 2:42756286-42756308 CATTTCCCCAGGCAGAGAGAGGG + Exonic
929881614 2:45841877-45841899 CACTGTCCCCAGCAAAGAGCAGG - Intronic
931528452 2:63185786-63185808 CAGTGTCCCAGGCAATGGGCTGG + Intronic
931994819 2:67829855-67829877 CATTGGCCCAGGGATTGAGTGGG - Intergenic
932337519 2:70939376-70939398 CATTGCCACAGGCAGAGGGCTGG - Exonic
933621876 2:84552373-84552395 CTGTGTGCCAGGCATAGTGCTGG - Intronic
934171065 2:89541510-89541532 CATAGTCCCTGGCATACAGCAGG - Intergenic
934281370 2:91615828-91615850 CATAGTCCCTGGCATACAGCAGG - Intergenic
934758438 2:96840231-96840253 CCTTGTCCCGGGCATTGACCCGG + Exonic
936093076 2:109513116-109513138 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
937204806 2:120228874-120228896 CAGTGTCCCAGCCATGGACCCGG - Intergenic
937891485 2:126942345-126942367 CATTGTCCCTGGCTTGTAGCAGG + Intergenic
941336794 2:164255438-164255460 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
941767819 2:169317392-169317414 CATTCTCTCAGGCAGAGAGGAGG - Intronic
941990986 2:171556735-171556757 CTTTGTGCCAGGCAGAGGGCTGG - Exonic
942575946 2:177363622-177363644 CACAGTGCCTGGCATAGAGCAGG + Intronic
942700682 2:178706150-178706172 CAATCTCCCAGGCATAGAGAGGG - Intronic
944104537 2:196065502-196065524 CAGCCTCCCAGGCACAGAGCAGG - Intronic
945966899 2:216197712-216197734 CAAAGTGCCTGGCATAGAGCTGG - Intronic
946417011 2:219544720-219544742 CACAGTCCCCGGCATAGTGCTGG - Exonic
946456721 2:219832453-219832475 CAACCTCCCAGGCACAGAGCAGG - Intergenic
947447343 2:230174147-230174169 CACTGCCCCAGGCATAGTACAGG + Intronic
1169488822 20:6054551-6054573 CATCCTCCCAGGCATGCAGCGGG - Intergenic
1173906292 20:46632080-46632102 CTCTGTGCCAGGCAGAGAGCTGG + Intronic
1173993601 20:47321221-47321243 CCTTGTACCCGGCATACAGCAGG + Intronic
1174351412 20:49970950-49970972 CCATCTCCCAGGCGTAGAGCTGG + Intergenic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1175955780 20:62608386-62608408 CATTGTCCACGGCAAGGAGCCGG - Intergenic
1177832404 21:26153659-26153681 CATTGTCCCAGACACAGCACTGG + Intronic
1179083555 21:38196059-38196081 CAGTCTCCTGGGCATAGAGCAGG - Intronic
1179541102 21:42083694-42083716 CATTGTGCCCGGCACATAGCAGG + Intronic
1181153635 22:20903154-20903176 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1181854202 22:25770622-25770644 CACAGTGCCAGGCACAGAGCAGG - Intronic
1183660364 22:39216416-39216438 CACTGTCACAGGCACAGGGCCGG + Intergenic
1183714437 22:39525459-39525481 CCTTGTCCCAGACACAAAGCAGG - Intergenic
1184945776 22:47802734-47802756 CATGGTCTCTGGCACAGAGCAGG + Intergenic
950111208 3:10419892-10419914 CATTGTCGCAGGGATCAAGCTGG - Intronic
950389618 3:12686294-12686316 CATTATGCCTGACATAGAGCTGG - Intergenic
952924667 3:38312505-38312527 CATTCACCCAGGCAGAGTGCTGG + Intronic
953125523 3:40088493-40088515 CATGGTACCTGGCACAGAGCAGG - Intronic
953388332 3:42519864-42519886 CAGTGTGCCAGGCACTGAGCTGG + Intronic
953648839 3:44781118-44781140 CTCTGTGCCAGGCATTGAGCTGG - Intronic
955406187 3:58627123-58627145 CATTCTCCCAGGCACAAAGGCGG + Exonic
956585234 3:70857107-70857129 CAATGTGCCAGGCACAGTGCGGG + Intergenic
956787311 3:72653303-72653325 CCTTGTGCCAGGCAGTGAGCTGG + Intergenic
960857548 3:122118777-122118799 CATGGTGCCTGGCATATAGCAGG + Intronic
961568608 3:127782527-127782549 CAATGGCCCAGGCAGAGTGCTGG + Intronic
963197247 3:142546040-142546062 CAGTGTCCCAGGTACGGAGCAGG - Intronic
963245645 3:143058142-143058164 CATTCTCCCAGGCAATGAGCAGG - Exonic
964955048 3:162344461-162344483 CATAGTCCCTGGCATATGGCAGG - Intergenic
966507282 3:180720353-180720375 CCTTTTCCTGGGCATAGAGCAGG + Intronic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
967853377 3:194098552-194098574 CATTGTCCCAGGCAGACAGCAGG + Intergenic
967921431 3:194617185-194617207 CAATGGCCGAGGCATAGAGGAGG + Exonic
968002264 3:195214244-195214266 CATGGTCCCATGCACAGAGGGGG - Intronic
969963746 4:10973373-10973395 CATTTTCCCAGGCTCAGTGCAGG + Intergenic
970133286 4:12894390-12894412 CATGGTGCCTGGCACAGAGCGGG + Intergenic
970403203 4:15737543-15737565 AAGTGTGCCAGGCATGGAGCTGG - Intronic
971155941 4:24083113-24083135 GACAGTTCCAGGCATAGAGCAGG - Intergenic
973134304 4:46687206-46687228 CCATGTCTCAAGCATAGAGCCGG + Intergenic
973258880 4:48140916-48140938 CATTATGCCTGGCACAGAGCAGG + Intronic
975611695 4:76210133-76210155 CATTGTGCGAGGCATTGTGCTGG + Intronic
977676681 4:99756081-99756103 CATTGTGCCAGGCAGAGGGGAGG + Intergenic
978189089 4:105893026-105893048 CTTTGTGCCAGGCATTGTGCTGG + Intronic
981732919 4:147918855-147918877 CGTTGTGCCTGGCATTGAGCTGG + Intronic
983238558 4:165207102-165207124 CAGTGTCCCAGGCAGGAAGCAGG - Intronic
983390734 4:167126927-167126949 CATAGGCCCAGGCACAGGGCAGG - Intronic
984818241 4:183857872-183857894 CATTATCCCAGGGAGAGAACAGG - Intronic
990646120 5:57846311-57846333 CAATGTGCCAAGCATTGAGCTGG + Intergenic
991698120 5:69292639-69292661 CTTTGTCCCAGGACTTGAGCAGG - Intronic
993603202 5:89954259-89954281 CATTTTCCCAGGAACTGAGCTGG - Intergenic
993618617 5:90142398-90142420 CATAGTACCAGGCACAGAGGAGG - Intergenic
996008488 5:118452704-118452726 CAGTGTCACTGGAATAGAGCTGG + Intergenic
997581606 5:135020664-135020686 CACTGTCCCAGGCATGGAGGGGG + Intergenic
999093499 5:148958023-148958045 CACTGTCCCAGGTATAGATTAGG - Intronic
1000038075 5:157463917-157463939 CATTGTCCCTGGCATACAGCAGG - Intronic
1002460222 5:179369608-179369630 CATTCTCCCAGGCCTAGGCCCGG + Intergenic
1002615431 5:180451798-180451820 AGTTCTCCCAGGCAGAGAGCTGG + Intergenic
1004271342 6:14198806-14198828 CCATGGCCCAGGCATACAGCAGG - Intergenic
1006063454 6:31442698-31442720 CAGGGTCACAGGCAGAGAGCAGG + Intergenic
1006827678 6:36948168-36948190 CATTGTGCCAGGCGCTGAGCTGG - Intergenic
1008397520 6:51025985-51026007 CATGGTCCTAGGAAAAGAGCTGG - Intergenic
1011411843 6:87074432-87074454 CATGGCCCCTGGCATGGAGCAGG + Intergenic
1012553071 6:100481985-100482007 CAGTGTCTGTGGCATAGAGCAGG - Intergenic
1016746119 6:147582025-147582047 CATTGACCTAGGCAGAGAGAGGG + Intronic
1016893792 6:149032811-149032833 CATTTCCCCAGGCAAAAAGCTGG + Intronic
1017118071 6:150997392-150997414 CATTGTCACAGACTTGGAGCCGG - Intronic
1018851505 6:167643793-167643815 CATTTTCCAAAGCATAGAGCTGG + Intergenic
1019465379 7:1185359-1185381 CCCTGTCCCAGGGACAGAGCTGG + Intergenic
1019783678 7:2959655-2959677 CCCTGTCCCAGCCACAGAGCAGG - Intronic
1019856145 7:3609987-3610009 CATCATACCTGGCATAGAGCTGG + Intronic
1020539936 7:9449273-9449295 CATTCTCCCATCCATATAGCTGG - Intergenic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1026895154 7:74006156-74006178 CATTGCCCGAGGCATAGATCTGG - Intergenic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1029420889 7:100471319-100471341 CTGTGTCCCAGGCAAAGAGGTGG - Intronic
1031688564 7:124762803-124762825 CATTGTTCCAGGCCTAAAGCTGG - Intronic
1033815597 7:145068890-145068912 CTTTGTCCGAGGTATAGGGCAGG - Intergenic
1035654757 8:1297037-1297059 GATTGTGCCTGGCACAGAGCAGG + Intergenic
1035933441 8:3810152-3810174 CATAGTGCCAGGCATATAGCAGG + Intronic
1037171819 8:15901699-15901721 CATTGTCACAGGCATAGTTGTGG + Intergenic
1037970305 8:23166961-23166983 CAATGTCCCGGTCATAGAGTTGG + Intergenic
1038971566 8:32642282-32642304 GATTGTCCCAAACTTAGAGCTGG - Intronic
1039834775 8:41247801-41247823 CAGAGTCCCAGACAAAGAGCAGG + Intergenic
1044756183 8:95463934-95463956 CATAGAGCCAGGCATATAGCAGG - Intergenic
1045681818 8:104668811-104668833 CATAGTCCCCGGCACAGAGTAGG + Intronic
1046530504 8:115439009-115439031 CCATGTCCCAGGGATAGAACAGG - Intronic
1047552289 8:125887722-125887744 CCTTGTCTCAGGCACAGGGCTGG + Intergenic
1048174018 8:132135295-132135317 TATTGGTCCAGGCATAGAGCAGG - Intronic
1048318280 8:133378013-133378035 AATTGTGCCTGGCATATAGCAGG + Intergenic
1048583226 8:135748203-135748225 CATTGTCCCAGGCAAGAAGGAGG - Intergenic
1048946570 8:139453940-139453962 AATCATCTCAGGCATAGAGCAGG + Intergenic
1048962945 8:139595146-139595168 CAGCCTCCCAGGCATAGAGCAGG + Intergenic
1049097620 8:140558179-140558201 CATTGTCCCATCCTTAGTGCTGG - Intronic
1051407814 9:16757673-16757695 CATTGTACCAGGAATATAGTAGG - Intronic
1053083364 9:35196307-35196329 AATTGTTCCATGCATAGAACTGG + Intronic
1054727321 9:68665475-68665497 TAGTGTCCCAGGCACTGAGCTGG - Intergenic
1056290442 9:85137931-85137953 CATTATCCCAGGATAAGAGCTGG - Intergenic
1057184497 9:93049401-93049423 CATGGGGCCAGGCACAGAGCAGG - Intergenic
1057509147 9:95663295-95663317 CATTGTGCCAGGCTCTGAGCCGG + Intergenic
1059742306 9:117163942-117163964 CATAGTGCCTGGCATATAGCAGG + Intronic
1060518083 9:124278402-124278424 TAGTGTCCCAGGCATTGAGGAGG + Intronic
1060670859 9:125467990-125468012 CAAGGTCACAGGCACAGAGCAGG + Exonic
1061512557 9:131069906-131069928 CCTGGTGCCCGGCATAGAGCTGG - Intronic
1061719027 9:132540216-132540238 CACTGTGCCAGGCTTAGAGCTGG + Intronic
1061903871 9:133686574-133686596 CAATGTGCCTGGCACAGAGCAGG + Intronic
1062335173 9:136061797-136061819 CAATGGCCCAGGTACAGAGCAGG + Intronic
1062349410 9:136131775-136131797 CATCTTCCCAGGCACAGAGTGGG + Intergenic
1187143381 X:16615579-16615601 CATTCCCCCAGGTCTAGAGCAGG - Intronic
1187200468 X:17129386-17129408 CATTATCCCAGGAAAAGAGATGG - Intronic
1187337640 X:18394777-18394799 CGGTTTCCCAGGCACAGAGCAGG + Intergenic
1188027086 X:25221110-25221132 TATTGTACCAGGCATAGTTCTGG + Intergenic
1196603768 X:117631928-117631950 CAGTGTGCCAGGCATAAAGTAGG - Intergenic
1196758579 X:119179379-119179401 CATGGTGCCTGGCATATAGCAGG - Intergenic
1197717418 X:129719543-129719565 TATTGTCCCTGGCACATAGCAGG + Intergenic
1199599434 X:149533233-149533255 CATGGTACCTGGCATATAGCAGG - Exonic
1199651197 X:149946974-149946996 CATGGTACCTGGCATATAGCAGG + Intergenic
1199825333 X:151493063-151493085 CTTTGTCCCTGGCTTAGTGCTGG - Intergenic