ID: 916169374

View in Genome Browser
Species Human (GRCh38)
Location 1:161989081-161989103
Sequence TGGCGCAATTGGAGTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916169374_916169376 -9 Left 916169374 1:161989081-161989103 CCTGGATCACTCCAATTGCGCCA 0: 1
1: 0
2: 0
3: 1
4: 40
Right 916169376 1:161989095-161989117 ATTGCGCCAGTTTGTCTCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916169374 Original CRISPR TGGCGCAATTGGAGTGATCC AGG (reversed) Intronic
904384290 1:30131468-30131490 TGGCTCAAAGGGAGTGAACCAGG - Intergenic
910870774 1:91830809-91830831 TGGTGCAAAAGGAATGATCCTGG + Intronic
912567092 1:110595485-110595507 TGGAGCAATTGAAGTGGTGCAGG - Intronic
915902606 1:159857209-159857231 TGGCGAATTTGGAGGGAGCCTGG - Intronic
916169374 1:161989081-161989103 TGGCGCAATTGGAGTGATCCAGG - Intronic
1071920734 10:90347157-90347179 GGGAGCAATTGCAGTGAACCTGG - Intergenic
1072521434 10:96233231-96233253 TGGAGCAAATGCAGTTATCCAGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1095232689 12:39760393-39760415 TGGAACAATTGGAGTAAACCAGG - Intronic
1101760529 12:107655025-107655047 TGGGGCAATTTGAGTGACCATGG - Intronic
1102768823 12:115455546-115455568 AGTGGCAATTGGAATGATCCAGG + Intergenic
1104385900 12:128351309-128351331 TGGGGCCATTGCAGTCATCCAGG + Intronic
1104717533 12:131026030-131026052 TGGCGCAATTGACATGAACCGGG - Intronic
1108519302 13:51231723-51231745 TGGAGCAACTGCAGGGATCCAGG - Intronic
1118558232 14:67050072-67050094 TGGTGCTATTGGATTGATACCGG - Intronic
1120436181 14:84485737-84485759 TGGAGCACATGGAATGATCCCGG + Intergenic
1122160665 14:99781703-99781725 TGGCCCCATTGCAGTGAACCTGG - Intronic
1122816359 14:104316056-104316078 TGGGGCATTTGGAGTTTTCCAGG + Intergenic
1128882523 15:71256791-71256813 TGGAGGTATTGGTGTGATCCTGG + Intronic
1133915992 16:10110510-10110532 GGAAGCTATTGGAGTGATCCAGG + Intronic
1141083784 16:81077073-81077095 TGTCGCCTTTGGAGTGGTCCCGG + Intronic
1150029567 17:61718724-61718746 TGGTGCAATTGTAGTATTCCAGG + Intronic
1153448676 18:5201157-5201179 TGGGGCAATTGGAATGTTTCAGG - Intergenic
1159078458 18:63708123-63708145 TGGCTAAATTGGAGTGAGCTTGG + Intronic
938650814 2:133381710-133381732 TGGTGCAATGGGAGAAATCCTGG - Intronic
939820619 2:146953101-146953123 TGGAGCAACTGCAGTGACCCAGG + Intergenic
939893116 2:147760756-147760778 TGGAGCCATTGATGTGATCCTGG + Intergenic
942588507 2:177513650-177513672 GGGCTCAATTTGAGTGATCAGGG + Intronic
946778151 2:223165418-223165440 TGGCTCACTTGGAGTGAGCAGGG + Intronic
949634559 3:5968662-5968684 TGGACAAATTGGAGTGAGCCAGG + Intergenic
977917822 4:102613481-102613503 CGAAGCAATTGAAGTGATCCAGG + Exonic
978226789 4:106344747-106344769 TGGCTCAAGTGGAGTGAACAAGG - Intronic
982787353 4:159551234-159551256 TGGCTCAAATGGAGTGAGCCAGG + Intergenic
995367352 5:111377871-111377893 TGGAGCATTTGCTGTGATCCAGG - Intronic
1002872318 6:1178036-1178058 TGGGACAATCGGAGTGAACCTGG - Intergenic
1010211079 6:73363312-73363334 TGGCTCCGTAGGAGTGATCCTGG + Intronic
1030587415 7:111437392-111437414 TGGGGCAATGGGCGTGATCTCGG - Intronic
1048881411 8:138875638-138875660 TGGAGCTATGGGATTGATCCAGG - Intronic
1050580176 9:7046165-7046187 TGTAGCAATTGGAGTCATCTTGG + Intronic
1189644684 X:43115193-43115215 TGGAGCATTTGGTGTGATCAGGG - Intergenic
1195239564 X:102937573-102937595 TGGTGCACAAGGAGTGATCCTGG + Exonic
1195298144 X:103500480-103500502 TGGTGCACAAGGAGTGATCCTGG - Exonic