ID: 916170533

View in Genome Browser
Species Human (GRCh38)
Location 1:161998463-161998485
Sequence CTTGAGTTACAGAGGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916170527_916170533 -4 Left 916170527 1:161998444-161998466 CCTTTCCTTAACACGACGGCTTG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 183
916170528_916170533 -9 Left 916170528 1:161998449-161998471 CCTTAACACGACGGCTTGAGTTA 0: 1
1: 0
2: 0
3: 0
4: 19
Right 916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916170533 Original CRISPR CTTGAGTTACAGAGGGGGCC TGG Intronic
900173597 1:1282148-1282170 CTTGAGTGCCAGATGGGGCTGGG - Intronic
900613003 1:3552307-3552329 CTTGTGTTCCTGTGGGGGCCTGG - Intronic
900661241 1:3785087-3785109 CTTGAGGTCCTGTGGGGGCCGGG + Exonic
900901114 1:5516695-5516717 TGTGGCTTACAGAGGGGGCCTGG - Intergenic
902788297 1:18747168-18747190 CCTGAGTCACAGAGGGTGTCAGG - Intronic
903069467 1:20719865-20719887 CTCGTGTTACAGAGAGGGCAAGG - Intronic
905808347 1:40893415-40893437 CATGTGTTAAAGAAGGGGCCTGG - Intergenic
911084814 1:93967624-93967646 ATTGAGTTTCAAAGAGGGCCAGG + Intergenic
915737926 1:158096258-158096280 ATAGGGTTACGGAGGGGGCCTGG + Intronic
915905413 1:159873295-159873317 CTTGAGTTACAAAATGGGGCTGG - Intronic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
921079314 1:211725942-211725964 TTTAAATCACAGAGGGGGCCGGG - Intergenic
922752763 1:228078425-228078447 CTGGAGTGACAGAGGCGGCCTGG - Intergenic
1063143486 10:3275852-3275874 CTTGAATTAGTGAGGGGGACGGG + Intergenic
1064097700 10:12436136-12436158 CTTGAGTCACAGATGAAGCCGGG - Intronic
1066426956 10:35316201-35316223 CTAGAGTAACAGAGCTGGCCAGG + Intronic
1067187788 10:44044813-44044835 CTTGAGGTCCAGAGGGGGCTGGG + Intergenic
1068595197 10:58895674-58895696 CTGGAGAGACAGAGGTGGCCAGG + Intergenic
1073078298 10:100838490-100838512 CCTGAGGGACAGAGGGGGACAGG + Intergenic
1076176374 10:128371226-128371248 CCAGTGTTACAGAAGGGGCCTGG - Intergenic
1076498257 10:130913756-130913778 CTTTATTTACAGAGGAGCCCTGG + Intergenic
1077581738 11:3421779-3421801 CATGAATTACAAATGGGGCCGGG + Intergenic
1081136819 11:39449615-39449637 CATGAGTCTCAGAAGGGGCCAGG - Intergenic
1084155588 11:67311013-67311035 CTTGAGTCCCAGACAGGGCCTGG - Intronic
1084319867 11:68367287-68367309 CTTTGTTTACAGAGGAGGCCAGG + Intronic
1084785951 11:71441767-71441789 CAACAATTACAGAGGGGGCCAGG - Intronic
1084833771 11:71788232-71788254 CATGAATTACAAATGGGGCCAGG - Intronic
1085763644 11:79263330-79263352 CTTGACTTACAGACAAGGCCAGG - Intronic
1087216684 11:95502533-95502555 TTTGAGTTACAGAAGGTGCCAGG + Intergenic
1087479484 11:98681017-98681039 CTGGGATTACAGAGGGGCCCCGG + Intergenic
1089671883 11:120062426-120062448 CTGCAGTGACAGAGGAGGCCCGG + Intergenic
1089768330 11:120784743-120784765 CTTGAGTTTCAGAGTCTGCCAGG + Intronic
1091180453 11:133599764-133599786 CTTGTGTTTCTGATGGGGCCTGG - Intergenic
1092205432 12:6611979-6612001 CTTGAGTTCCAGAAAGGGCTCGG + Intergenic
1094167127 12:27454277-27454299 ATTGATTCACAGAGAGGGCCAGG - Intergenic
1096138790 12:49225241-49225263 GTTGAGATAGAGAGTGGGCCTGG - Intronic
1097173713 12:57130851-57130873 CTGGAGATACAGAGGGGGCGTGG - Intronic
1097252552 12:57644381-57644403 CATAAGATACAGAGAGGGCCGGG - Intergenic
1098651447 12:72975464-72975486 CATGAGTTACAGATTGGGACTGG + Intergenic
1098866653 12:75771443-75771465 CCTGACTCACAGTGGGGGCCTGG - Intergenic
1099138837 12:78943559-78943581 CCAGTGTTAAAGAGGGGGCCTGG - Intronic
1101305352 12:103522420-103522442 CTGGTGTTACAGAGAGGGCCGGG - Intergenic
1102746511 12:115253536-115253558 CTCTAGTGACAGAGAGGGCCAGG + Intergenic
1104094155 12:125541287-125541309 CTTGAGTTTCAGAAGGAGCCAGG + Intronic
1109398759 13:61796585-61796607 CATGGGTTACAGAGGGCCCCTGG - Intergenic
1110474915 13:75902466-75902488 CTTGAGGTACAGAGGTGGCAGGG - Intergenic
1113583764 13:111448781-111448803 CTCGATTTACAGAGAGGGCGTGG + Intergenic
1117329765 14:54701020-54701042 CTTGGGTGACAGAGGAGACCTGG - Intronic
1118184513 14:63524686-63524708 CATGAGTTGCACAGGGGCCCAGG + Intronic
1119157296 14:72422842-72422864 CTTGACTTGCAGATGGGCCCTGG - Intronic
1119377898 14:74209367-74209389 CCTGGGTTGCAGAGGGGTCCTGG - Intergenic
1121442963 14:93960251-93960273 CCTCAGTTACAGAGGGACCCTGG - Intronic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1122127294 14:99586237-99586259 CTTGGGAGACAGATGGGGCCTGG - Intronic
1125826828 15:42683919-42683941 ATTGAGGAACAGAGTGGGCCTGG + Intronic
1126585981 15:50287939-50287961 TTTGAGTGACAGAGGAGGCATGG - Intronic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1130168558 15:81487539-81487561 GTTGAATTACATAGAGGGCCAGG - Intergenic
1132103250 15:99043159-99043181 CCAGAGTTACAGAGGGAGCATGG + Intergenic
1132155405 15:99492435-99492457 GTAGGGTTACAGAGGGGGCTCGG - Intergenic
1132515335 16:363368-363390 CTGGAGTTACAGACGGGCACTGG + Intergenic
1132786753 16:1661294-1661316 CCTGGGTGACAGAGGGGGCCGGG + Intronic
1132786768 16:1661333-1661355 CCTGGGTGACGGAGGGGGCCGGG + Intronic
1132786785 16:1661372-1661394 CCTGGGTGACGGAGGGGGCCGGG + Intronic
1132786802 16:1661411-1661433 CCTGGGTGACGGAGGGGGCCGGG + Intronic
1132786819 16:1661450-1661472 CCTGGGTGACGGAGGGGGCCGGG + Intronic
1132786836 16:1661489-1661511 CCTGGGTGACGGAGGGGGCCGGG + Intronic
1133706844 16:8363022-8363044 CTTAAGTTACAATGGGGGGCAGG - Intergenic
1134191223 16:12122510-12122532 CTGGAGTGAGGGAGGGGGCCAGG + Intronic
1135721410 16:24821538-24821560 CTTGAGTTGCAGATGGGGTCAGG + Intronic
1138013249 16:53404227-53404249 CTGGAGTTAAAGAGTGGGACAGG + Intergenic
1138541114 16:57688434-57688456 CTTGAGATGCGGAGTGGGCCTGG - Exonic
1143016763 17:3894924-3894946 CTTGACTCACAGAGGAGGCTTGG + Intergenic
1143910490 17:10244945-10244967 CTCGGGTGACAGAGTGGGCCCGG - Intergenic
1144761278 17:17708985-17709007 CCTCAGTTGCAGAGTGGGCCAGG + Intronic
1146000253 17:29126475-29126497 CCTGATTCACAGAGTGGGCCAGG + Intronic
1148163813 17:45468412-45468434 CTTGAGTTCCAGAGGCTGCCTGG + Exonic
1149507061 17:57203268-57203290 CTGTACTTACAGAGGAGGCCTGG + Intergenic
1150395043 17:64815066-64815088 CTTGAGTTCCAGAGGCTGCCTGG + Intergenic
1151361757 17:73593269-73593291 CTTGAATTACAGAGGTGTCTGGG - Intronic
1152208856 17:78992212-78992234 CTTGAGTTTCAAAGGGGGAGAGG + Exonic
1152283518 17:79399137-79399159 CTGGAGTCTCAGAGGGGGCATGG + Intronic
1152344699 17:79743879-79743901 CTGGATTTACAGAGGAGGACAGG - Intergenic
1152434122 17:80264744-80264766 CCTGAGTTACAGCGGGGGCAGGG - Intronic
1153344680 18:4012530-4012552 CCCAAGCTACAGAGGGGGCCTGG + Intronic
1153637718 18:7127519-7127541 ATTGAATTACAGAGGGCGTCGGG - Intergenic
1156339812 18:36200884-36200906 AGTGAGTTACAGAGGGAGTCTGG + Intronic
1157124105 18:44938579-44938601 CATGATTTACAGAGGAGGCGGGG + Intronic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1161897675 19:7094713-7094735 CATAAGATACAAAGGGGGCCGGG - Intergenic
1162805021 19:13133270-13133292 ATAGAATTACAGAGGAGGCCGGG + Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163282793 19:16327197-16327219 CTTCAGTCACAGACGGGGGCTGG - Exonic
1165251904 19:34545422-34545444 CTTCAGTGACAGAAGAGGCCTGG - Intergenic
1165268524 19:34682719-34682741 CTTCAGTGACAGAAGAGGCCTGG + Intronic
1165274774 19:34739090-34739112 CTTCAGTGACAGAAGAGGCCTGG + Intronic
1165312752 19:35038923-35038945 CTCGAGTTACACAGGGAGGCAGG + Intronic
1166817723 19:45556944-45556966 CCTGTGTTACAGAGGGGCCTTGG - Intronic
1167388420 19:49178415-49178437 CTTGAGCTATAGCTGGGGCCAGG + Intronic
1168523019 19:57067707-57067729 CTTAATTTACAGAGGTGGCCCGG - Intergenic
1168595072 19:57668865-57668887 CTGGTGAAACAGAGGGGGCCCGG - Intergenic
925504842 2:4550571-4550593 GTTGAGTTCCAGAGTGGGACAGG - Intergenic
927845434 2:26469813-26469835 CTTGGGTCACAGAAAGGGCCTGG + Intronic
930350976 2:50253992-50254014 CTAGAGATACAGAGGGGAGCTGG - Intronic
931257265 2:60584543-60584565 CTGGAGTTACAGAGGGAGTTGGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
932744922 2:74325989-74326011 TGTGAGAAACAGAGGGGGCCTGG + Intronic
934942754 2:98514268-98514290 CTGGAGTTAGAGAGGGGGTGTGG + Intronic
935155853 2:100482860-100482882 CATGAGAAACAGAGGAGGCCCGG - Intronic
935217886 2:100988896-100988918 CTGGAGGAACAGTGGGGGCCTGG - Intronic
935469041 2:103434706-103434728 CTTCAGTGACAAAGGAGGCCTGG - Intergenic
935807972 2:106767561-106767583 CTTCAGTTCCAGAGGTGCCCAGG + Intergenic
936732834 2:115404997-115405019 CATGAGTTATAGGGGGAGCCAGG - Intronic
938277456 2:130038555-130038577 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938328426 2:130429358-130429380 CTTCAGTCACAGATGGGGGCTGG - Intergenic
938361520 2:130692136-130692158 CTTCAGTCACAGATGGGGGCTGG + Intergenic
938437927 2:131298825-131298847 CTTCAGTCACAGATGGGGGCTGG + Intronic
938768531 2:134480228-134480250 CTTGAGGAACAGAGGAGGCAGGG - Intronic
941803483 2:169687223-169687245 CATGAGATTTAGAGGGGGCCAGG - Intronic
944425284 2:199575589-199575611 CCTGAGTTACAGGAAGGGCCTGG - Intergenic
946766706 2:223047265-223047287 CTGGTGTTACAGGGAGGGCCTGG + Intergenic
948668904 2:239553836-239553858 CTGGAGGTGCAGAGGGGCCCGGG - Intergenic
1169966914 20:11228103-11228125 CTTGATTTCTAGTGGGGGCCAGG + Intergenic
1172267529 20:33629697-33629719 CCTGAGTCACAGAGGGGGCCAGG - Exonic
1173736999 20:45369130-45369152 GTTGAGTTCCAGAGAGGGCAGGG + Exonic
1176032071 20:63017488-63017510 CAGGACTTGCAGAGGGGGCCTGG + Intergenic
1177649343 21:23940383-23940405 CTTTGGCTACAGAGGAGGCCAGG + Intergenic
1178389240 21:32185083-32185105 CTTGATTGACAGAGAGGGGCTGG - Intergenic
1178628633 21:34240203-34240225 CCAGAGTTAAAGATGGGGCCTGG - Intergenic
1178912095 21:36683257-36683279 CTTGAGGTACAAAGGGGAGCAGG - Intergenic
1179384768 21:40931727-40931749 GTTGAGTTACAGATGGGGTGCGG + Intergenic
1179461476 21:41538336-41538358 CTGGAGTTGCAGAGAGGCCCGGG + Intergenic
1179658189 21:42858605-42858627 CATGAGGGACAGATGGGGCCTGG + Intronic
1184123597 22:42471023-42471045 CCTGAGATACAGAGGGAGCTGGG - Intergenic
1184924963 22:47630356-47630378 CTTCAGCCACAGAGGTGGCCAGG + Intergenic
949996723 3:9623117-9623139 CTACAGTTACAGAGGGAGCATGG + Intergenic
950224650 3:11223782-11223804 CTTGTTTAACAGAGGAGGCCTGG + Intronic
950792080 3:15480113-15480135 CTGGGGTTGCAGTGGGGGCCTGG - Intronic
952041358 3:29265758-29265780 CTTGAGTTACACAGGGGCTTGGG + Intergenic
952632595 3:35487546-35487568 CTAGAGTTCCAGAGGGAGGCTGG - Intergenic
953031718 3:39184176-39184198 CTGGAGCTACAGACGGGGCCAGG - Exonic
956656795 3:71560095-71560117 CTTCAGGTACAGATGGAGCCAGG - Intronic
961300251 3:125917320-125917342 CATGAATTACAAATGGGGCCGGG - Intergenic
962670832 3:137707031-137707053 CTGGAGTTCCTAAGGGGGCCAGG - Intergenic
962755897 3:138465220-138465242 CTTGAGGCACTGAGGGGGTCAGG + Intronic
966225110 3:177589966-177589988 CTTGAAGTAGAGAGGGGGGCGGG - Intergenic
966578968 3:181537660-181537682 CTTGAGGTACAAATAGGGCCAGG - Intergenic
967788942 3:193526806-193526828 CTTTAGTTAGAGAGGGCTCCAGG + Intronic
968066413 3:195761943-195761965 CTTGGGGCACAGAGCGGGCCGGG - Intronic
968628180 4:1637417-1637439 CTCGAGGGACAGAGGGAGCCTGG + Intronic
969073656 4:4559697-4559719 CTTGTGATACAGAGAGAGCCTGG + Intergenic
969100763 4:4766496-4766518 CCTGAGTAACAGAGGGGTCCTGG + Intergenic
969592364 4:8129267-8129289 AGTGAGTCACAGAGGGGGCGGGG - Intronic
969634410 4:8358365-8358387 CTTGAGTTAAGGTGGGGGCGGGG - Intergenic
971072837 4:23114065-23114087 CTTGCATTTCAGAGGGGGCAAGG + Intergenic
972931531 4:44077458-44077480 CTTGAGTTACATAGGTGGGAAGG + Intergenic
976230724 4:82840307-82840329 CTTGAGTGAAAGAGGTGGCGTGG - Intronic
977419055 4:96774318-96774340 TTTGAGATACAGTGTGGGCCTGG - Intergenic
979092816 4:116508052-116508074 ATTGAGAAACAGAGGAGGCCAGG - Intergenic
983021925 4:162687265-162687287 CTTGATTTGGAGAGTGGGCCAGG + Intergenic
983778494 4:171639465-171639487 TTAGAGTTACAGAGGGTGGCTGG + Intergenic
985907515 5:2852569-2852591 CCAGAGTTCCAGAGGGAGCCTGG - Intergenic
985977748 5:3434398-3434420 TATAAGTGACAGAGGGGGCCAGG - Intergenic
990726855 5:58765817-58765839 CCAGAGTTACAGGAGGGGCCTGG + Intronic
992188139 5:74263683-74263705 CTTGAGTCGTGGAGGGGGCCTGG - Intergenic
1004424421 6:15497751-15497773 CTGGAGTTAAAGCAGGGGCCGGG + Intronic
1005957123 6:30671976-30671998 TTTAATTAACAGAGGGGGCCGGG - Intronic
1008678029 6:53842567-53842589 CTAGAGTTAGAGAGTGGGCTGGG + Intronic
1008760465 6:54846898-54846920 CTTGGGGTACTGGGGGGGCCCGG + Intronic
1009836454 6:69007448-69007470 CTAGAGTTGAAGAGGGGGCTGGG - Intronic
1013296179 6:108760279-108760301 CTTGAGACAGAGAGAGGGCCAGG - Intergenic
1017552260 6:155521758-155521780 CTTGAGTTACAGACAAGGACTGG + Intergenic
1018905586 6:168073600-168073622 TTTGAGGCACAGAAGGGGCCGGG + Intronic
1019061826 6:169262761-169262783 CAGGAGGTACGGAGGGGGCCTGG - Intergenic
1019142916 6:169959605-169959627 TTTGAGACACAGAGGCGGCCCGG - Intergenic
1019342880 7:516916-516938 CAGGGATTACAGAGGGGGCCGGG + Intronic
1022342289 7:29479933-29479955 TTTGAGTGATGGAGGGGGCCCGG - Intronic
1022960937 7:35425933-35425955 CTTGAGTAACAGAGGCAGCTGGG - Intergenic
1023863438 7:44228181-44228203 CGGGCGTTACAGAGGAGGCCTGG + Intronic
1024972801 7:55086201-55086223 CTCGAGTTAAAGAGCTGGCCAGG + Intronic
1029490276 7:100866874-100866896 CCAGAGTCACAGAGGAGGCCTGG - Exonic
1031839956 7:126725974-126725996 CTAGTGTTAGAGATGGGGCCTGG - Intronic
1034188580 7:149196893-149196915 CTTGAGTCAGAGAGTGGGGCTGG + Intronic
1037087079 8:14865639-14865661 CTTCAATTACATAAGGGGCCAGG + Intronic
1039579829 8:38655712-38655734 CTTGAGTTAAGGAAGGGGCTAGG + Intergenic
1042145054 8:65719449-65719471 CTTTATTTACAGAATGGGCCAGG - Exonic
1044605214 8:94042132-94042154 CCTGAGCTAGAGAGAGGGCCAGG + Intergenic
1046983369 8:120360940-120360962 CTGGAGTTGCAGAGGAGGCAGGG - Intronic
1047716093 8:127596596-127596618 CTTGAGTTTCAGAGAGGTTCAGG + Intergenic
1049717701 8:144100700-144100722 CTTGAGGTTCAGTGGGGGCCGGG - Intronic
1053465686 9:38306769-38306791 CCTGAGATAGAGAGGAGGCCAGG + Intergenic
1055353355 9:75412353-75412375 CTGGGGCTACAGAGGAGGCCTGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060826090 9:126688857-126688879 CTTGAGGATCAGATGGGGCCAGG + Intronic
1060945543 9:127568036-127568058 CCGGAGCTGCAGAGGGGGCCTGG - Intronic
1061008880 9:127943717-127943739 CCTCATTTTCAGAGGGGGCCAGG + Intronic
1061889975 9:133613833-133613855 CGTGATTCACAGAGGGAGCCGGG - Intergenic
1061979774 9:134095268-134095290 CTTGGGAGACTGAGGGGGCCAGG + Intergenic
1062026323 9:134342340-134342362 CCTCATTTACAGAGGGGGCCTGG + Intronic
1062377271 9:136267840-136267862 CCTGGGTGACAGAGGGGGGCAGG - Intergenic
1062702557 9:137915057-137915079 CCTGCTTTACAGAGGGGCCCAGG + Intronic
1187405557 X:19000752-19000774 CCTGGGTGACAGAGGGGGGCCGG - Intronic
1200115110 X:153766494-153766516 TGTGAGTCACAGAGGGGGCAGGG - Intronic
1200139899 X:153894941-153894963 CTTGAGAAACAGAGTGGGCCAGG - Intronic